Incidental Mutation 'R8814:Hemgn'
ID 672595
Institutional Source Beutler Lab
Gene Symbol Hemgn
Ensembl Gene ENSMUSG00000028332
Gene Name hemogen
Synonyms 4921524M03Rik, EDAG
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 46393989-46404183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 46400717 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 48 (Q48K)
Ref Sequence ENSEMBL: ENSMUSP00000066383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071096] [ENSMUST00000107764]
AlphaFold Q9ERZ0
Predicted Effect possibly damaging
Transcript: ENSMUST00000071096
AA Change: Q48K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066383
Gene: ENSMUSG00000028332
AA Change: Q48K

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107764
AA Change: Q48K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103393
Gene: ENSMUSG00000028332
AA Change: Q48K

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Hemgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Hemgn APN 4 46,396,240 (GRCm39) missense probably benign
IGL00846:Hemgn APN 4 46,396,171 (GRCm39) missense possibly damaging 0.91
IGL00930:Hemgn APN 4 46,396,383 (GRCm39) nonsense probably null
IGL01875:Hemgn APN 4 46,396,994 (GRCm39) missense possibly damaging 0.65
IGL01937:Hemgn APN 4 46,396,057 (GRCm39) missense probably damaging 1.00
IGL02217:Hemgn APN 4 46,396,420 (GRCm39) missense probably damaging 0.98
IGL02325:Hemgn APN 4 46,396,085 (GRCm39) missense probably benign 0.05
IGL02746:Hemgn APN 4 46,400,740 (GRCm39) missense probably damaging 0.99
IGL03093:Hemgn APN 4 46,396,504 (GRCm39) missense probably benign 0.26
IGL03240:Hemgn APN 4 46,400,732 (GRCm39) nonsense probably null
PIT4504001:Hemgn UTSW 4 46,395,863 (GRCm39) missense probably benign
R0925:Hemgn UTSW 4 46,397,049 (GRCm39) missense probably damaging 0.98
R1413:Hemgn UTSW 4 46,396,091 (GRCm39) missense possibly damaging 0.94
R1795:Hemgn UTSW 4 46,395,958 (GRCm39) missense probably damaging 0.97
R1844:Hemgn UTSW 4 46,396,655 (GRCm39) missense possibly damaging 0.85
R2152:Hemgn UTSW 4 46,396,607 (GRCm39) nonsense probably null
R2169:Hemgn UTSW 4 46,396,417 (GRCm39) missense possibly damaging 0.92
R2207:Hemgn UTSW 4 46,396,301 (GRCm39) missense possibly damaging 0.66
R3742:Hemgn UTSW 4 46,396,421 (GRCm39) missense possibly damaging 0.94
R4515:Hemgn UTSW 4 46,396,477 (GRCm39) missense probably damaging 0.98
R5310:Hemgn UTSW 4 46,403,927 (GRCm39) missense possibly damaging 0.77
R5445:Hemgn UTSW 4 46,400,738 (GRCm39) missense probably benign 0.09
R5456:Hemgn UTSW 4 46,396,571 (GRCm39) missense probably damaging 0.99
R6520:Hemgn UTSW 4 46,396,466 (GRCm39) missense probably damaging 0.98
R6575:Hemgn UTSW 4 46,395,990 (GRCm39) missense possibly damaging 0.46
R6983:Hemgn UTSW 4 46,395,997 (GRCm39) missense possibly damaging 0.92
R7204:Hemgn UTSW 4 46,397,054 (GRCm39) missense possibly damaging 0.94
R7443:Hemgn UTSW 4 46,396,145 (GRCm39) missense probably damaging 0.96
R7567:Hemgn UTSW 4 46,397,034 (GRCm39) missense probably damaging 0.96
R7623:Hemgn UTSW 4 46,396,504 (GRCm39) missense probably benign 0.07
R8181:Hemgn UTSW 4 46,396,504 (GRCm39) missense possibly damaging 0.52
R8353:Hemgn UTSW 4 46,403,935 (GRCm39) missense possibly damaging 0.92
R8714:Hemgn UTSW 4 46,395,904 (GRCm39) missense probably damaging 1.00
R8725:Hemgn UTSW 4 46,394,638 (GRCm39) missense probably benign 0.03
R8865:Hemgn UTSW 4 46,396,682 (GRCm39) missense possibly damaging 0.90
R9164:Hemgn UTSW 4 46,396,106 (GRCm39) missense probably benign 0.03
R9335:Hemgn UTSW 4 46,394,647 (GRCm39) missense probably benign 0.09
Z1177:Hemgn UTSW 4 46,400,693 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACCCACTGGATTCTGCATTAG -3'
(R):5'- CCCAGGATAGGGTTTCTAAAATTC -3'

Sequencing Primer
(F):5'- TTCTGCATTAGAAGCAAACACAC -3'
(R):5'- ACCGGACATTCATATGGTGC -3'
Posted On 2021-04-30