Incidental Mutation 'R8814:Mterf1b'
ID 672598
Institutional Source Beutler Lab
Gene Symbol Mterf1b
Ensembl Gene ENSMUSG00000053178
Gene Name mitochondrial transcription termination factor 1b
Synonyms Gm9897
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 4192367-4197651 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4197456 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 366 (S366P)
Ref Sequence ENSEMBL: ENSMUSP00000135408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177258]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000177258
AA Change: S366P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135408
Gene: ENSMUSG00000053178
AA Change: S366P

DomainStartEndE-ValueType
low complexity region 43 61 N/A INTRINSIC
Mterf 106 136 1.62e2 SMART
Mterf 141 173 5.81e1 SMART
Mterf 178 208 3.63e0 SMART
Mterf 219 250 8.87e-4 SMART
Mterf 295 325 9.87e2 SMART
Mterf 326 356 1.1e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele of both Mterf1a and Mterf1b exhibit impaired transcription initiation at light-strand promoters resulting in a decrease of de novo transcription and reduced 7S RNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
Brd7 A G 8: 88,345,154 V361A probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cacna2d3 T A 14: 29,097,815 Y532F probably damaging Het
Cep85l A T 10: 53,348,969 Y175N probably benign Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Crispld2 A G 8: 120,015,345 H144R possibly damaging Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hace1 A G 10: 45,652,701 Y346C probably damaging Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Nrxn1 A T 17: 90,630,101 C643S probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr485 T A 7: 108,159,065 K269N probably benign Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Scarb1 A T 5: 125,294,092 D305E probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slfn8 A G 11: 83,016,679 V346A possibly damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Soga1 C T 2: 157,030,531 W965* probably null Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Uaca A G 9: 60,866,398 N396D possibly damaging Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Vps8 T C 16: 21,576,650 L1230P probably damaging Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Mterf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Mterf1b APN 5 4196503 missense probably benign 0.01
IGL02754:Mterf1b APN 5 4196478 missense possibly damaging 0.93
R0410:Mterf1b UTSW 5 4196488 missense probably benign 0.41
R1474:Mterf1b UTSW 5 4197163 missense probably damaging 1.00
R1875:Mterf1b UTSW 5 4197364 missense possibly damaging 0.96
R2089:Mterf1b UTSW 5 4197057 missense possibly damaging 0.77
R2091:Mterf1b UTSW 5 4197057 missense possibly damaging 0.77
R2091:Mterf1b UTSW 5 4197057 missense possibly damaging 0.77
R4657:Mterf1b UTSW 5 4197176 nonsense probably null
R4689:Mterf1b UTSW 5 4197263 nonsense probably null
R5462:Mterf1b UTSW 5 4196541 missense probably benign 0.04
R5750:Mterf1b UTSW 5 4196683 missense probably damaging 1.00
R5813:Mterf1b UTSW 5 4196956 missense possibly damaging 0.92
R6028:Mterf1b UTSW 5 4197666 splice site probably null
R6248:Mterf1b UTSW 5 4196606 missense probably benign 0.02
R8842:Mterf1b UTSW 5 4196961 missense possibly damaging 0.93
R8962:Mterf1b UTSW 5 4196437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTATCTGAATATGGTCTTCTTGTC -3'
(R):5'- ACATGTGTCTGCTGTGAAAAGTC -3'

Sequencing Primer
(F):5'- CGAGGATTTTAGACTCCAGC -3'
(R):5'- CATGACTAAGTTGGTCCCTGGAAC -3'
Posted On 2021-04-30