Mutagenetix > Incidental Mutation

Incidental Mutation 'T0970:Nup98'

67260

Institutional Source

Beutler Lab

Gene Symbol

Nup98

Ensembl Gene

ENSMUSG00000063550

Gene Name

nucleoporin 98

Synonyms

Nup96

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

T0970 (G3) of strain 713

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

101768607-101859359 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to C at 101835959 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211005] [ENSMUST00000211022] [ENSMUST00000211235]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000070165

SMART Domains

Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550

Domain	Start	End	E-Value	Type
Pfam:Nucleoporin_FG	3	88	4.6e-4	PFAM
Pfam:Nucleoporin_FG	69	170	3.4e-6	PFAM
Pfam:Nucleoporin_FG	210	307	6.1e-5	PFAM
Pfam:Nucleoporin_FG	246	332	2.2e-7	PFAM
Pfam:Nucleoporin_FG	266	359	1.2e-7	PFAM
Pfam:Nucleoporin_FG	309	425	1.8e-2	PFAM
Pfam:Nucleoporin_FG	398	497	2.2e-2	PFAM
low complexity region	594	610	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
Pfam:Nucleoporin2	740	880	5.4e-45	PFAM
PDB:1KO6\|D	881	925	1e-16	PDB
low complexity region	926	935	N/A	INTRINSIC
low complexity region	1033	1042	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209242

Predicted Effect

probably benign
Transcript: ENSMUST00000210682

Predicted Effect

probably benign
Transcript: ENSMUST00000211005

Predicted Effect

probably benign
Transcript: ENSMUST00000211022

Predicted Effect

probably benign
Transcript: ENSMUST00000211235

Predicted Effect

probably benign
Transcript: ENSMUST00000211764

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.3%
20x: 94.7%

Validation Efficiency

100% (25/25)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano4	A	T	10: 88,817,052 (GRCm39)	L591*	probably null	Het
Aqp4	A	G	18: 15,532,940 (GRCm39)	L51P	probably damaging	Het
Cemip	A	T	7: 83,632,354 (GRCm39)	C403S	probably damaging	Het
Cfap74	G	T	4: 155,547,574 (GRCm39)		probably null	Het
Glis3	G	A	19: 28,508,332 (GRCm39)	R551W	probably damaging	Het
Gm11232	T	A	4: 71,674,740 (GRCm39)	Y254F	possibly damaging	Het
Map3k14	G	T	11: 103,115,124 (GRCm39)	C837*	probably null	Het
Mrc2	A	C	11: 105,238,453 (GRCm39)	E1200A	probably benign	Het
Nfix	T	C	8: 85,453,112 (GRCm39)	N314S	possibly damaging	Het
Nphp4	T	C	4: 152,640,836 (GRCm39)	S1068P	probably damaging	Het
Or13p8	A	G	4: 118,583,464 (GRCm39)	R7G	probably benign	Het
Pcdhac2	T	C	18: 37,278,388 (GRCm39)	V456A	possibly damaging	Het
Pcdhb1	G	T	18: 37,399,026 (GRCm39)	G326C	probably damaging	Het
Prss38	A	G	11: 59,263,974 (GRCm39)	V246A	possibly damaging	Het
Rnf26	C	G	9: 44,023,369 (GRCm39)	R172P	probably damaging	Het
Septin4	A	T	11: 87,458,558 (GRCm39)	T311S	probably damaging	Het
Serinc3	TATCATC	TATC	2: 163,469,835 (GRCm39)		probably benign	Het
Spire1	C	A	18: 67,634,133 (GRCm39)		probably null	Het
Tex2	T	A	11: 106,437,772 (GRCm39)	I633F	unknown	Het
Tle2	A	G	10: 81,416,119 (GRCm39)	D108G	possibly damaging	Het
Txnrd2	T	C	16: 18,260,523 (GRCm39)	V185A	probably damaging	Het
Unc45b	C	A	11: 82,813,714 (GRCm39)	H374N	probably benign	Het
Wtap	T	C	17: 13,188,277 (GRCm39)		probably benign	Het

Other mutations in Nup98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Nup98	APN	7	101,844,194 (GRCm39)	missense	probably damaging	1.00
IGL00789:Nup98	APN	7	101,803,178 (GRCm39)	missense	probably benign
IGL00798:Nup98	APN	7	101,796,411 (GRCm39)	missense	probably damaging	1.00
IGL01562:Nup98	APN	7	101,835,125 (GRCm39)	missense	probably damaging	0.99
IGL01942:Nup98	APN	7	101,843,918 (GRCm39)	missense	probably damaging	1.00
IGL02109:Nup98	APN	7	101,832,693 (GRCm39)	missense	probably benign	0.37
IGL02490:Nup98	APN	7	101,801,573 (GRCm39)	missense	probably damaging	1.00
IGL03184:Nup98	APN	7	101,832,752 (GRCm39)	missense	probably damaging	0.99
PIT4519001:Nup98	UTSW	7	101,784,171 (GRCm39)	missense	probably benign	0.00
R0040:Nup98	UTSW	7	101,841,241 (GRCm39)	missense	probably damaging	1.00
R0133:Nup98	UTSW	7	101,788,859 (GRCm39)	critical splice acceptor site	probably null
R0309:Nup98	UTSW	7	101,801,635 (GRCm39)	missense	probably null
R0471:Nup98	UTSW	7	101,788,004 (GRCm39)	missense	probably benign	0.13
R0538:Nup98	UTSW	7	101,835,892 (GRCm39)	missense	probably damaging	1.00
R0650:Nup98	UTSW	7	101,801,660 (GRCm39)	missense	probably damaging	1.00
R0730:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R0881:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R0900:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1120:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1159:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1469:Nup98	UTSW	7	101,788,008 (GRCm39)	missense	probably benign	0.00
R1469:Nup98	UTSW	7	101,788,008 (GRCm39)	missense	probably benign	0.00
R1470:Nup98	UTSW	7	101,796,513 (GRCm39)	missense	probably damaging	0.98
R1470:Nup98	UTSW	7	101,796,513 (GRCm39)	missense	probably damaging	0.98
R1545:Nup98	UTSW	7	101,784,087 (GRCm39)	missense	possibly damaging	0.77
R1775:Nup98	UTSW	7	101,784,144 (GRCm39)	missense	probably benign	0.03
R1889:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R2080:Nup98	UTSW	7	101,829,631 (GRCm39)	missense	probably damaging	0.96
R3423:Nup98	UTSW	7	101,834,084 (GRCm39)	missense	probably benign	0.03
R4361:Nup98	UTSW	7	101,794,921 (GRCm39)	missense	probably damaging	1.00
R4678:Nup98	UTSW	7	101,834,038 (GRCm39)	missense	probably damaging	1.00
R4864:Nup98	UTSW	7	101,802,403 (GRCm39)	missense	possibly damaging	0.94
R4910:Nup98	UTSW	7	101,845,007 (GRCm39)	missense	unknown
R4924:Nup98	UTSW	7	101,784,185 (GRCm39)	missense	probably damaging	1.00
R5068:Nup98	UTSW	7	101,794,862 (GRCm39)	missense	probably benign	0.00
R5069:Nup98	UTSW	7	101,794,862 (GRCm39)	missense	probably benign	0.00
R5233:Nup98	UTSW	7	101,845,029 (GRCm39)	missense	unknown
R5779:Nup98	UTSW	7	101,801,568 (GRCm39)	missense	probably benign
R5922:Nup98	UTSW	7	101,803,224 (GRCm39)	missense	probably damaging	1.00
R6010:Nup98	UTSW	7	101,829,636 (GRCm39)	missense	probably damaging	1.00
R6039:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R6039:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R6343:Nup98	UTSW	7	101,843,957 (GRCm39)	missense	possibly damaging	0.90
R6364:Nup98	UTSW	7	101,825,522 (GRCm39)	missense	probably damaging	1.00
R6462:Nup98	UTSW	7	101,844,223 (GRCm39)	missense	probably benign	0.03
R6577:Nup98	UTSW	7	101,778,053 (GRCm39)	splice site	probably null
R6900:Nup98	UTSW	7	101,835,169 (GRCm39)	missense	probably damaging	1.00
R7205:Nup98	UTSW	7	101,844,248 (GRCm39)	missense	unknown
R7218:Nup98	UTSW	7	101,841,107 (GRCm39)	splice site	probably null
R7235:Nup98	UTSW	7	101,774,491 (GRCm39)	missense	probably damaging	1.00
R7307:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R7402:Nup98	UTSW	7	101,784,144 (GRCm39)	missense	probably benign	0.00
R7427:Nup98	UTSW	7	101,784,208 (GRCm39)	splice site	probably null
R7428:Nup98	UTSW	7	101,784,208 (GRCm39)	splice site	probably null
R7584:Nup98	UTSW	7	101,825,596 (GRCm39)	missense	probably benign	0.02
R7646:Nup98	UTSW	7	101,803,242 (GRCm39)	missense	probably benign	0.01
R7648:Nup98	UTSW	7	101,773,404 (GRCm39)	missense	possibly damaging	0.94
R7742:Nup98	UTSW	7	101,802,464 (GRCm39)	splice site	probably null
R7827:Nup98	UTSW	7	101,773,569 (GRCm39)	missense	probably benign	0.10
R7884:Nup98	UTSW	7	101,825,556 (GRCm39)	missense	probably benign	0.12
R7943:Nup98	UTSW	7	101,844,029 (GRCm39)	missense	probably benign	0.10
R8034:Nup98	UTSW	7	101,794,930 (GRCm39)	critical splice acceptor site	probably null
R8952:Nup98	UTSW	7	101,835,859 (GRCm39)	missense	probably damaging	1.00
R9060:Nup98	UTSW	7	101,783,895 (GRCm39)	missense	probably damaging	1.00
R9099:Nup98	UTSW	7	101,844,173 (GRCm39)	missense	probably damaging	0.98
R9146:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9148:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9223:Nup98	UTSW	7	101,834,167 (GRCm39)	missense	possibly damaging	0.82
R9246:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9249:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9272:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9274:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9283:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9326:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9466:Nup98	UTSW	7	101,818,611 (GRCm39)	missense	probably benign	0.05
R9492:Nup98	UTSW	7	101,778,252 (GRCm39)	missense	probably benign	0.11
R9661:Nup98	UTSW	7	101,782,019 (GRCm39)	nonsense	probably null
X0054:Nup98	UTSW	7	101,796,415 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGACAGTCAAGGTGGAAGCTAATTTT -3'
(R):5'- TGGGCACTACATGGTCTCCTAATGATG -3'

Sequencing Primer
(F):5'- ACGTCAGGCTATTATTCAGAACC -3'
(R):5'- GCAGTATTATAGTCTTTGCCCTAACT -3'

Posted On

2013-09-03