Incidental Mutation 'R8814:Scarb1'
ID 672600
Institutional Source Beutler Lab
Gene Symbol Scarb1
Ensembl Gene ENSMUSG00000037936
Gene Name scavenger receptor class B, member 1
Synonyms Cd36l1, Srb1, Hdlq1, SRBI, Hlb398, Cla-1, SR-BI, D5Ertd460e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 125277087-125341094 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 125294092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 305 (D305E)
Ref Sequence ENSEMBL: ENSMUSP00000083242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086075] [ENSMUST00000111390] [ENSMUST00000127148]
AlphaFold Q61009
PDB Structure Molecular analysis of the interaction of the HDL-receptor SR-BI with the PDZ3 domain of its adaptor protein PDZK1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000086075
AA Change: D305E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000083242
Gene: ENSMUSG00000037936
AA Change: D305E

DomainStartEndE-ValueType
Pfam:CD36 16 463 6.4e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111390
AA Change: D305E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107021
Gene: ENSMUSG00000037936
AA Change: D305E

DomainStartEndE-ValueType
Pfam:CD36 14 465 4.7e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127148
AA Change: D6E

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122100
Gene: ENSMUSG00000037936
AA Change: D6E

DomainStartEndE-ValueType
Pfam:CD36 1 123 1.2e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane receptor for high density lipoprotein cholesterol (HDL). The encoded protein mediates cholesterol transfer to and from HDL. In addition, this protein is a receptor for hepatitis C virus glycoprotein E2. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Targeted mutations result in abnormal lipoprotein metablolism and, for one allele, reversible female infertility. An ENU mutant shows increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
Brd7 A G 8: 88,345,154 V361A probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cacna2d3 T A 14: 29,097,815 Y532F probably damaging Het
Cep85l A T 10: 53,348,969 Y175N probably benign Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Crispld2 A G 8: 120,015,345 H144R possibly damaging Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hace1 A G 10: 45,652,701 Y346C probably damaging Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Mterf1b T C 5: 4,197,456 S366P probably damaging Het
Nrxn1 A T 17: 90,630,101 C643S probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr485 T A 7: 108,159,065 K269N probably benign Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slfn8 A G 11: 83,016,679 V346A possibly damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Soga1 C T 2: 157,030,531 W965* probably null Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Uaca A G 9: 60,866,398 N396D possibly damaging Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Vps8 T C 16: 21,576,650 L1230P probably damaging Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Scarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Scarb1 APN 5 125289702 missense probably benign 0.01
IGL03052:Scarb1 UTSW 5 125294099 missense probably damaging 1.00
R0051:Scarb1 UTSW 5 125281100 splice site probably null
R0317:Scarb1 UTSW 5 125289692 missense probably damaging 0.99
R0455:Scarb1 UTSW 5 125289681 missense probably damaging 0.96
R0491:Scarb1 UTSW 5 125298731 unclassified probably benign
R0655:Scarb1 UTSW 5 125300440 missense probably damaging 1.00
R0676:Scarb1 UTSW 5 125297214 unclassified probably benign
R2074:Scarb1 UTSW 5 125294143 missense probably benign
R2267:Scarb1 UTSW 5 125287375 missense possibly damaging 0.82
R3951:Scarb1 UTSW 5 125287411 missense probably damaging 0.99
R4080:Scarb1 UTSW 5 125277795 missense probably damaging 1.00
R4452:Scarb1 UTSW 5 125300345 missense probably damaging 1.00
R4925:Scarb1 UTSW 5 125297299 missense probably damaging 1.00
R5669:Scarb1 UTSW 5 125300387 missense probably damaging 1.00
R5809:Scarb1 UTSW 5 125304222 missense probably damaging 0.98
R5872:Scarb1 UTSW 5 125304277 missense possibly damaging 0.60
R5883:Scarb1 UTSW 5 125340907 unclassified probably benign
R6321:Scarb1 UTSW 5 125304331 missense probably damaging 1.00
R6508:Scarb1 UTSW 5 125304325 missense possibly damaging 0.49
R6618:Scarb1 UTSW 5 125304330 missense probably damaging 0.96
R6931:Scarb1 UTSW 5 125284719 missense probably damaging 1.00
R7058:Scarb1 UTSW 5 125297230 missense probably damaging 1.00
R7099:Scarb1 UTSW 5 125304350 missense probably damaging 0.98
R7146:Scarb1 UTSW 5 125284025 missense probably benign
R7830:Scarb1 UTSW 5 125287383 missense probably damaging 1.00
R7873:Scarb1 UTSW 5 125294039 missense probably damaging 1.00
R8158:Scarb1 UTSW 5 125303137 missense probably benign 0.01
R8467:Scarb1 UTSW 5 125298667 missense probably damaging 0.99
R8500:Scarb1 UTSW 5 125294163 missense probably damaging 1.00
R9025:Scarb1 UTSW 5 125304350 missense probably damaging 0.98
R9169:Scarb1 UTSW 5 125294082 missense probably damaging 1.00
R9462:Scarb1 UTSW 5 125340827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATCATGGGTGCAGAGACC -3'
(R):5'- TGAAGTTTCCTCAGCAACAGG -3'

Sequencing Primer
(F):5'- TGCAGAGACCAGAGATTAATGGGAC -3'
(R):5'- GTTTCCTCAGCAACAGGTGACTAG -3'
Posted On 2021-04-30