Incidental Mutation 'R8814:Scarb1'
ID 672600
Institutional Source Beutler Lab
Gene Symbol Scarb1
Ensembl Gene ENSMUSG00000037936
Gene Name scavenger receptor class B, member 1
Synonyms Cd36l1, Srb1, Hdlq1, SRBI, D5Ertd460e, Chohd1, SR-BI, Cla-1, Chohd1, Hlb398
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 125354151-125418158 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 125371156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 305 (D305E)
Ref Sequence ENSEMBL: ENSMUSP00000083242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086075] [ENSMUST00000111390] [ENSMUST00000127148]
AlphaFold Q61009
PDB Structure Molecular analysis of the interaction of the HDL-receptor SR-BI with the PDZ3 domain of its adaptor protein PDZK1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000086075
AA Change: D305E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000083242
Gene: ENSMUSG00000037936
AA Change: D305E

DomainStartEndE-ValueType
Pfam:CD36 16 463 6.4e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111390
AA Change: D305E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107021
Gene: ENSMUSG00000037936
AA Change: D305E

DomainStartEndE-ValueType
Pfam:CD36 14 465 4.7e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127148
AA Change: D6E

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122100
Gene: ENSMUSG00000037936
AA Change: D6E

DomainStartEndE-ValueType
Pfam:CD36 1 123 1.2e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane receptor for high density lipoprotein cholesterol (HDL). The encoded protein mediates cholesterol transfer to and from HDL. In addition, this protein is a receptor for hepatitis C virus glycoprotein E2. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Targeted mutations result in abnormal lipoprotein metablolism and, for one allele, reversible female infertility. An ENU mutant shows increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Scarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Scarb1 APN 5 125,366,766 (GRCm39) missense probably benign 0.01
IGL03052:Scarb1 UTSW 5 125,371,163 (GRCm39) missense probably damaging 1.00
R0051:Scarb1 UTSW 5 125,358,164 (GRCm39) splice site probably null
R0317:Scarb1 UTSW 5 125,366,756 (GRCm39) missense probably damaging 0.99
R0455:Scarb1 UTSW 5 125,366,745 (GRCm39) missense probably damaging 0.96
R0491:Scarb1 UTSW 5 125,375,795 (GRCm39) unclassified probably benign
R0655:Scarb1 UTSW 5 125,377,504 (GRCm39) missense probably damaging 1.00
R0676:Scarb1 UTSW 5 125,374,278 (GRCm39) unclassified probably benign
R2074:Scarb1 UTSW 5 125,371,207 (GRCm39) missense probably benign
R2267:Scarb1 UTSW 5 125,364,439 (GRCm39) missense possibly damaging 0.82
R3951:Scarb1 UTSW 5 125,364,475 (GRCm39) missense probably damaging 0.99
R4080:Scarb1 UTSW 5 125,354,859 (GRCm39) missense probably damaging 1.00
R4452:Scarb1 UTSW 5 125,377,409 (GRCm39) missense probably damaging 1.00
R4925:Scarb1 UTSW 5 125,374,363 (GRCm39) missense probably damaging 1.00
R5669:Scarb1 UTSW 5 125,377,451 (GRCm39) missense probably damaging 1.00
R5809:Scarb1 UTSW 5 125,381,286 (GRCm39) missense probably damaging 0.98
R5872:Scarb1 UTSW 5 125,381,341 (GRCm39) missense possibly damaging 0.60
R5883:Scarb1 UTSW 5 125,417,971 (GRCm39) unclassified probably benign
R6321:Scarb1 UTSW 5 125,381,395 (GRCm39) missense probably damaging 1.00
R6508:Scarb1 UTSW 5 125,381,389 (GRCm39) missense possibly damaging 0.49
R6618:Scarb1 UTSW 5 125,381,394 (GRCm39) missense probably damaging 0.96
R6931:Scarb1 UTSW 5 125,361,783 (GRCm39) missense probably damaging 1.00
R7058:Scarb1 UTSW 5 125,374,294 (GRCm39) missense probably damaging 1.00
R7099:Scarb1 UTSW 5 125,381,414 (GRCm39) missense probably damaging 0.98
R7146:Scarb1 UTSW 5 125,361,089 (GRCm39) missense probably benign
R7830:Scarb1 UTSW 5 125,364,447 (GRCm39) missense probably damaging 1.00
R7873:Scarb1 UTSW 5 125,371,103 (GRCm39) missense probably damaging 1.00
R8158:Scarb1 UTSW 5 125,380,201 (GRCm39) missense probably benign 0.01
R8467:Scarb1 UTSW 5 125,375,731 (GRCm39) missense probably damaging 0.99
R8500:Scarb1 UTSW 5 125,371,227 (GRCm39) missense probably damaging 1.00
R9025:Scarb1 UTSW 5 125,381,414 (GRCm39) missense probably damaging 0.98
R9169:Scarb1 UTSW 5 125,371,146 (GRCm39) missense probably damaging 1.00
R9462:Scarb1 UTSW 5 125,417,891 (GRCm39) missense probably damaging 1.00
R9685:Scarb1 UTSW 5 125,371,194 (GRCm39) missense possibly damaging 0.49
R9699:Scarb1 UTSW 5 125,374,296 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATCATGGGTGCAGAGACC -3'
(R):5'- TGAAGTTTCCTCAGCAACAGG -3'

Sequencing Primer
(F):5'- TGCAGAGACCAGAGATTAATGGGAC -3'
(R):5'- GTTTCCTCAGCAACAGGTGACTAG -3'
Posted On 2021-04-30