Incidental Mutation 'R8814:Cpsf4'
ID 672601
Institutional Source Beutler Lab
Gene Symbol Cpsf4
Ensembl Gene ENSMUSG00000029625
Gene Name cleavage and polyadenylation specific factor 4
Synonyms 30kDa
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 145104023-145118851 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 145115678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 201 (S201R)
Ref Sequence ENSEMBL: ENSMUSP00000124899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037056] [ENSMUST00000070487] [ENSMUST00000160422] [ENSMUST00000160574] [ENSMUST00000160629] [ENSMUST00000161741] [ENSMUST00000162244] [ENSMUST00000162360]
AlphaFold Q8BQZ5
Predicted Effect probably benign
Transcript: ENSMUST00000037056
SMART Domains Protein: ENSMUSP00000039726
Gene: ENSMUSG00000038690

DomainStartEndE-ValueType
Pfam:WRW 1 73 1.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070487
AA Change: S169R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069243
Gene: ENSMUSG00000029625
AA Change: S169R

DomainStartEndE-ValueType
ZnF_C3H1 35 61 1.7e-5 SMART
ZnF_C3H1 62 88 1.4e-10 SMART
ZnF_C3H1 90 110 3.7e-1 SMART
ZnF_C3H1 111 136 3.4e-9 SMART
low complexity region 143 157 N/A INTRINSIC
ZnF_C2HC 186 202 4.5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160422
AA Change: S227R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125019
Gene: ENSMUSG00000029625
AA Change: S227R

DomainStartEndE-ValueType
ZnF_C3H1 35 61 4.17e-3 SMART
ZnF_C3H1 62 88 3.41e-8 SMART
ZnF_C3H1 90 116 6.42e-4 SMART
ZnF_C3H1 118 142 2.86e-1 SMART
ZnF_C3H1 143 168 8.27e-7 SMART
low complexity region 175 191 N/A INTRINSIC
ZnF_C2HC 244 260 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160574
Predicted Effect probably benign
Transcript: ENSMUST00000160629
AA Change: S201R

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124899
Gene: ENSMUSG00000029625
AA Change: S201R

DomainStartEndE-ValueType
ZnF_C3H1 35 61 4.17e-3 SMART
ZnF_C3H1 62 88 3.41e-8 SMART
ZnF_C3H1 90 116 6.42e-4 SMART
ZnF_C3H1 118 142 2.86e-1 SMART
ZnF_C3H1 143 168 8.27e-7 SMART
low complexity region 175 189 N/A INTRINSIC
ZnF_C2HC 218 234 1.04e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000125640
Gene: ENSMUSG00000029625
AA Change: S186A

DomainStartEndE-ValueType
ZnF_C3H1 3 29 4.17e-3 SMART
ZnF_C3H1 30 56 3.41e-8 SMART
ZnF_C3H1 58 84 6.42e-4 SMART
ZnF_C3H1 86 110 2.86e-1 SMART
ZnF_C3H1 111 136 8.27e-7 SMART
low complexity region 143 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161741
SMART Domains Protein: ENSMUSP00000125504
Gene: ENSMUSG00000038690

DomainStartEndE-ValueType
Pfam:WRW 6 84 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162244
AA Change: S202R

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124966
Gene: ENSMUSG00000029625
AA Change: S202R

DomainStartEndE-ValueType
ZnF_C3H1 35 61 4.17e-3 SMART
ZnF_C3H1 62 88 3.41e-8 SMART
ZnF_C3H1 90 116 6.42e-4 SMART
ZnF_C3H1 118 142 2.86e-1 SMART
ZnF_C3H1 143 168 8.27e-7 SMART
low complexity region 175 195 N/A INTRINSIC
ZnF_C2HC 219 235 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162360
Meta Mutation Damage Score 0.0577 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inhibition of the nuclear export of poly(A)-containing mRNAs caused by the influenza A virus NS1 protein requires its effector domain. The NS1 effector domain functionally interacts with the cellular 30 kDa subunit of cleavage and polyadenylation specific factor 4, an essential component of the 3' end processing machinery of cellular pre-mRNAs. In influenza virus-infected cells, the NS1 protein is physically associated with cleavage and polyadenylation specific factor 4, 30kD subunit. Binding of the NS1 protein to the 30 kDa protein in vitro prevents CPSF binding to the RNA substrate and inhibits 3' end cleavage and polyadenylation of host pre-mRNAs. Thus the NS1 protein selectively inhibits the nuclear export of cellular, and not viral, mRNAs. Multiple alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Cpsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB010:Cpsf4 UTSW 5 145,104,168 (GRCm39) start codon destroyed probably null 0.77
BB020:Cpsf4 UTSW 5 145,104,168 (GRCm39) start codon destroyed probably null 0.77
R0446:Cpsf4 UTSW 5 145,114,054 (GRCm39) missense probably damaging 1.00
R2144:Cpsf4 UTSW 5 145,115,572 (GRCm39) missense probably benign 0.00
R5813:Cpsf4 UTSW 5 145,115,683 (GRCm39) missense probably benign
R6958:Cpsf4 UTSW 5 145,112,402 (GRCm39) missense probably benign 0.22
R7037:Cpsf4 UTSW 5 145,112,939 (GRCm39) missense possibly damaging 0.51
R7933:Cpsf4 UTSW 5 145,104,168 (GRCm39) start codon destroyed probably null 0.77
Z1176:Cpsf4 UTSW 5 145,104,225 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ATTATGCAGGAGAGGTCCCG -3'
(R):5'- CCTTTACTCTGCAAATCAGCAC -3'

Sequencing Primer
(F):5'- TTCCTGTCCCCATTGGTAGTC -3'
(R):5'- TCTGCAAATCAGCACTAATAAAAATG -3'
Posted On 2021-04-30