Mutagenetix > Incidental Mutation

Incidental Mutation 'R8814:Vmn2r70'

672605

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r70

Ensembl Gene

ENSMUSG00000090806

Gene Name

vomeronasal 2, receptor 70

Synonyms

EG620835

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R8814 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85558703-85569088 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85565961 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 122 (I122F)

Ref Sequence

ENSEMBL: ENSMUSP00000129703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168230]

AlphaFold

K7N702

Predicted Effect

probably benign
Transcript: ENSMUST00000168230
AA Change: I122F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000129703
Gene: ENSMUSG00000090806
AA Change: I122F

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:ANF_receptor	77	468	2.5e-28	PFAM
Pfam:NCD3G	510	562	1.5e-19	PFAM
Pfam:7tm_3	592	830	1.2e-52	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	C	6: 129,325,604		probably benign	Het
Brd7	A	G	8: 88,345,154	V361A	probably benign	Het
C6	A	T	15: 4,792,784	Q595L	probably benign	Het
Cacna2d3	T	A	14: 29,097,815	Y532F	probably damaging	Het
Cep85l	A	T	10: 53,348,969	Y175N	probably benign	Het
Clca3a2	G	T	3: 144,797,764	N808K	probably benign	Het
Cpsf4	T	G	5: 145,178,868	S201R	probably benign	Het
Crispld2	A	G	8: 120,015,345	H144R	possibly damaging	Het
Cyp1b1	T	C	17: 79,713,359	E318G	probably benign	Het
Fam109a	G	T	5: 121,853,045	V157L	probably benign	Het
Fer1l4	A	G	2: 156,052,243	F47L	probably benign	Het
Flnb	A	G	14: 7,927,409	D1873G	probably damaging	Het
Gm47995	A	G	1: 151,198,988	M181V	probably benign	Het
Hace1	A	G	10: 45,652,701	Y346C	probably damaging	Het
Hemgn	G	T	4: 46,400,717	Q48K	possibly damaging	Het
Hhip	T	C	8: 80,051,472	D143G	probably damaging	Het
Ift74	C	T	4: 94,662,636	Q342*	probably null	Het
Kng2	A	T	16: 23,004,011	I197N	probably benign	Het
Lcat	G	A	8: 105,941,970	P167S	probably damaging	Het
Lmntd2	G	A	7: 141,210,084	R672W	probably damaging	Het
Mroh2b	G	T	15: 4,941,625	L1037F	possibly damaging	Het
Msh4	A	G	3: 153,872,320	S640P	probably damaging	Het
Mterf1b	T	C	5: 4,197,456	S366P	probably damaging	Het
Nrxn1	A	T	17: 90,630,101	C643S	probably damaging	Het
Olfr1164	T	A	2: 88,092,971	I322F	probably benign	Het
Olfr1496	T	A	19: 13,781,533	I305N	possibly damaging	Het
Olfr485	T	A	7: 108,159,065	K269N	probably benign	Het
Olfr605	A	G	7: 103,442,913	V70A	probably benign	Het
Olfr709-ps1	T	A	7: 106,926,818	I214F	probably damaging	Het
Pask	C	A	1: 93,320,585	R998L	probably benign	Het
Pcdh8	A	G	14: 79,768,897	L742P	probably benign	Het
Psma3	A	G	12: 70,978,806	E32G	probably benign	Het
Samd11	T	C	4: 156,247,884	E500G	probably benign	Het
Scarb1	A	T	5: 125,294,092	D305E	probably benign	Het
Serpinb6b	A	G	13: 32,978,304	H362R	possibly damaging	Het
Siglec1	G	A	2: 131,072,744	T1484M	probably damaging	Het
Slfn8	A	G	11: 83,016,679	V346A	possibly damaging	Het
Slitrk6	G	C	14: 110,749,938	A779G	probably benign	Het
Soga1	C	T	2: 157,030,531	W965*	probably null	Het
Sub1	A	C	15: 11,984,231	V124G	probably damaging	Het
Tbc1d32	A	G	10: 56,196,592	I277T	possibly damaging	Het
Tln2	C	A	9: 67,221,411	E1465D	possibly damaging	Het
Trappc10	A	G	10: 78,202,919	Y780H	probably damaging	Het
Trim28	T	A	7: 13,028,527	N359K	probably damaging	Het
Tspan15	G	A	10: 62,188,056	T281M	probably benign	Het
Uaca	A	G	9: 60,866,398	N396D	possibly damaging	Het
Vmn1r84	A	G	7: 12,362,458	S103P	probably damaging	Het
Vmn2r22	C	G	6: 123,637,830	R267T	probably damaging	Het
Vmn2r7	A	G	3: 64,716,563	I112T	probably benign	Het
Vmn2r79	C	G	7: 87,002,506	T371S	probably benign	Het
Vps8	T	C	16: 21,576,650	L1230P	probably damaging	Het
Zfp26	A	T	9: 20,438,434	V278D	probably benign	Het

Other mutations in Vmn2r70

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Vmn2r70	APN	7	85563799	missense	probably benign	0.00
IGL01140:Vmn2r70	APN	7	85565171	nonsense	probably null
IGL01287:Vmn2r70	APN	7	85569019	nonsense	probably null
IGL01581:Vmn2r70	APN	7	85563914	splice site	probably null
IGL01632:Vmn2r70	APN	7	85566072	missense	probably benign	0.00
IGL01725:Vmn2r70	APN	7	85559386	missense	probably damaging	1.00
IGL02244:Vmn2r70	APN	7	85565003	missense	probably benign
IGL02288:Vmn2r70	APN	7	85565134	missense	probably benign	0.31
IGL02313:Vmn2r70	APN	7	85565168	missense	probably damaging	0.99
IGL02591:Vmn2r70	APN	7	85564945	missense	probably damaging	0.96
IGL02725:Vmn2r70	APN	7	85565345	missense	possibly damaging	0.46
IGL02797:Vmn2r70	APN	7	85559087	missense	probably benign	0.00
R0045:Vmn2r70	UTSW	7	85566044	missense	probably damaging	1.00
R0729:Vmn2r70	UTSW	7	85565904	missense	probably benign	0.00
R0967:Vmn2r70	UTSW	7	85559619	missense	probably damaging	0.99
R1217:Vmn2r70	UTSW	7	85559061	missense	probably damaging	1.00
R1351:Vmn2r70	UTSW	7	85565054	missense	probably damaging	1.00
R1387:Vmn2r70	UTSW	7	85558761	missense	probably benign	0.12
R1483:Vmn2r70	UTSW	7	85559167	missense	probably benign	0.04
R1796:Vmn2r70	UTSW	7	85563803	nonsense	probably null
R1809:Vmn2r70	UTSW	7	85565922	missense	probably benign	0.23
R2154:Vmn2r70	UTSW	7	85563715	missense	possibly damaging	0.67
R2173:Vmn2r70	UTSW	7	85565082	missense	probably benign
R2334:Vmn2r70	UTSW	7	85559592	missense	probably benign	0.05
R2871:Vmn2r70	UTSW	7	85559019	missense	probably damaging	1.00
R2871:Vmn2r70	UTSW	7	85559019	missense	probably damaging	1.00
R3975:Vmn2r70	UTSW	7	85559332	missense	probably benign	0.00
R4525:Vmn2r70	UTSW	7	85559579	missense	probably damaging	1.00
R4527:Vmn2r70	UTSW	7	85559579	missense	probably damaging	1.00
R4535:Vmn2r70	UTSW	7	85565333	missense	probably damaging	1.00
R5181:Vmn2r70	UTSW	7	85559179	missense	probably damaging	0.99
R5600:Vmn2r70	UTSW	7	85563727	missense	probably benign	0.07
R5641:Vmn2r70	UTSW	7	85559364	missense	probably damaging	0.99
R5726:Vmn2r70	UTSW	7	85559107	missense	probably damaging	1.00
R5943:Vmn2r70	UTSW	7	85565991	missense	probably benign	0.09
R6166:Vmn2r70	UTSW	7	85565981	missense	probably benign	0.25
R6272:Vmn2r70	UTSW	7	85558986	missense	probably damaging	1.00
R6324:Vmn2r70	UTSW	7	85558879	missense	probably benign	0.01
R6429:Vmn2r70	UTSW	7	85559068	missense	probably damaging	1.00
R6449:Vmn2r70	UTSW	7	85564949	missense	probably damaging	1.00
R6512:Vmn2r70	UTSW	7	85566097	missense	probably benign
R7000:Vmn2r70	UTSW	7	85559611	missense	probably damaging	0.99
R7141:Vmn2r70	UTSW	7	85558836	missense	probably benign
R7153:Vmn2r70	UTSW	7	85565054	missense	probably damaging	1.00
R7424:Vmn2r70	UTSW	7	85563868	missense	probably damaging	1.00
R7565:Vmn2r70	UTSW	7	85565291	missense	probably benign	0.35
R7567:Vmn2r70	UTSW	7	85565035	missense	probably benign	0.41
R7593:Vmn2r70	UTSW	7	85566104	nonsense	probably null
R7660:Vmn2r70	UTSW	7	85568922	missense	probably damaging	0.99
R7806:Vmn2r70	UTSW	7	85559193	missense	probably benign
R7892:Vmn2r70	UTSW	7	85559380	missense	possibly damaging	0.58
R7965:Vmn2r70	UTSW	7	85561863	missense	probably damaging	0.96
R8052:Vmn2r70	UTSW	7	85563715	missense	probably benign
R8251:Vmn2r70	UTSW	7	85565978	nonsense	probably null
R8934:Vmn2r70	UTSW	7	85561980	missense	possibly damaging	0.87
R9225:Vmn2r70	UTSW	7	85559034	missense	probably damaging	1.00
R9322:Vmn2r70	UTSW	7	85559290	missense	possibly damaging	0.92
R9430:Vmn2r70	UTSW	7	85566032	missense	probably benign	0.10
R9477:Vmn2r70	UTSW	7	85569036	missense	possibly damaging	0.50
Z1088:Vmn2r70	UTSW	7	85564760	missense	possibly damaging	0.53
Z1176:Vmn2r70	UTSW	7	85569045	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CACAATACTGCTGTCTCCCA -3'
(R):5'- TGCTTGTACAGGCGTAGGAATT -3'

Sequencing Primer
(F):5'- GCCTTCATATTCAAAAAGTCTCACTG -3'
(R):5'- ACTATTCTGTTTTTAGGGTGACACC -3'

Posted On

2021-04-30