Incidental Mutation 'R8814:Vmn2r79'
ID 672606
Institutional Source Beutler Lab
Gene Symbol Vmn2r79
Ensembl Gene ENSMUSG00000090362
Gene Name vomeronasal 2, receptor 79
Synonyms EG621430
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 86645673-86687176 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 86651714 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 371 (T371S)
Ref Sequence ENSEMBL: ENSMUSP00000132478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164462]
AlphaFold E9Q067
Predicted Effect probably benign
Transcript: ENSMUST00000164462
AA Change: T371S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: T371S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 75 464 1.9e-31 PFAM
Pfam:NCD3G 506 559 3.1e-21 PFAM
Pfam:7tm_3 592 827 2.8e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Vmn2r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Vmn2r79 APN 7 86,686,481 (GRCm39) missense probably benign 0.01
IGL01675:Vmn2r79 APN 7 86,645,856 (GRCm39) missense probably benign 0.01
IGL01760:Vmn2r79 APN 7 86,651,366 (GRCm39) missense probably benign
IGL01834:Vmn2r79 APN 7 86,686,354 (GRCm39) missense probably benign 0.01
IGL01843:Vmn2r79 APN 7 86,686,485 (GRCm39) missense probably damaging 1.00
IGL01914:Vmn2r79 APN 7 86,686,571 (GRCm39) missense probably benign 0.14
IGL01980:Vmn2r79 APN 7 86,686,290 (GRCm39) missense possibly damaging 0.49
IGL02438:Vmn2r79 APN 7 86,651,744 (GRCm39) missense probably damaging 0.98
IGL02740:Vmn2r79 APN 7 86,653,366 (GRCm39) missense probably benign 0.00
IGL03052:Vmn2r79 UTSW 7 86,652,799 (GRCm39) missense probably benign 0.00
PIT4445001:Vmn2r79 UTSW 7 86,651,408 (GRCm39) missense possibly damaging 0.46
R0096:Vmn2r79 UTSW 7 86,686,527 (GRCm39) missense probably damaging 1.00
R0096:Vmn2r79 UTSW 7 86,686,527 (GRCm39) missense probably damaging 1.00
R0270:Vmn2r79 UTSW 7 86,652,594 (GRCm39) missense probably benign 0.00
R0336:Vmn2r79 UTSW 7 86,651,287 (GRCm39) missense probably benign 0.15
R0418:Vmn2r79 UTSW 7 86,651,611 (GRCm39) missense probably benign 0.18
R1070:Vmn2r79 UTSW 7 86,652,681 (GRCm39) missense probably damaging 1.00
R1234:Vmn2r79 UTSW 7 86,653,307 (GRCm39) missense possibly damaging 0.71
R1459:Vmn2r79 UTSW 7 86,687,002 (GRCm39) missense probably benign 0.01
R1513:Vmn2r79 UTSW 7 86,686,652 (GRCm39) missense probably benign 0.01
R1624:Vmn2r79 UTSW 7 86,653,247 (GRCm39) critical splice acceptor site probably null
R1633:Vmn2r79 UTSW 7 86,687,042 (GRCm39) missense possibly damaging 0.52
R1676:Vmn2r79 UTSW 7 86,651,839 (GRCm39) missense probably benign
R1781:Vmn2r79 UTSW 7 86,651,555 (GRCm39) missense probably benign 0.00
R1794:Vmn2r79 UTSW 7 86,650,621 (GRCm39) missense probably benign 0.37
R1823:Vmn2r79 UTSW 7 86,687,080 (GRCm39) missense probably damaging 1.00
R2013:Vmn2r79 UTSW 7 86,653,289 (GRCm39) missense possibly damaging 0.50
R2018:Vmn2r79 UTSW 7 86,651,634 (GRCm39) missense probably benign 0.07
R2019:Vmn2r79 UTSW 7 86,651,634 (GRCm39) missense probably benign 0.07
R2177:Vmn2r79 UTSW 7 86,645,839 (GRCm39) missense possibly damaging 0.94
R2984:Vmn2r79 UTSW 7 86,651,099 (GRCm39) missense possibly damaging 0.85
R3719:Vmn2r79 UTSW 7 86,651,245 (GRCm39) missense probably benign 0.05
R3798:Vmn2r79 UTSW 7 86,651,402 (GRCm39) missense possibly damaging 0.88
R3969:Vmn2r79 UTSW 7 86,652,801 (GRCm39) missense probably damaging 1.00
R4182:Vmn2r79 UTSW 7 86,651,099 (GRCm39) missense possibly damaging 0.85
R4183:Vmn2r79 UTSW 7 86,651,099 (GRCm39) missense possibly damaging 0.85
R4245:Vmn2r79 UTSW 7 86,651,624 (GRCm39) missense possibly damaging 0.73
R4301:Vmn2r79 UTSW 7 86,651,099 (GRCm39) missense possibly damaging 0.85
R4391:Vmn2r79 UTSW 7 86,651,099 (GRCm39) missense possibly damaging 0.85
R4393:Vmn2r79 UTSW 7 86,651,099 (GRCm39) missense possibly damaging 0.85
R4394:Vmn2r79 UTSW 7 86,651,099 (GRCm39) missense possibly damaging 0.85
R4396:Vmn2r79 UTSW 7 86,651,099 (GRCm39) missense possibly damaging 0.85
R4397:Vmn2r79 UTSW 7 86,651,099 (GRCm39) missense possibly damaging 0.85
R4592:Vmn2r79 UTSW 7 86,653,319 (GRCm39) missense possibly damaging 0.86
R4697:Vmn2r79 UTSW 7 86,687,168 (GRCm39) missense probably damaging 0.98
R4897:Vmn2r79 UTSW 7 86,650,675 (GRCm39) missense probably benign
R5016:Vmn2r79 UTSW 7 86,686,548 (GRCm39) missense probably benign 0.00
R5058:Vmn2r79 UTSW 7 86,651,423 (GRCm39) missense probably damaging 0.98
R5177:Vmn2r79 UTSW 7 86,651,177 (GRCm39) missense probably damaging 0.97
R6078:Vmn2r79 UTSW 7 86,653,319 (GRCm39) missense possibly damaging 0.86
R6079:Vmn2r79 UTSW 7 86,653,319 (GRCm39) missense possibly damaging 0.86
R6138:Vmn2r79 UTSW 7 86,653,319 (GRCm39) missense possibly damaging 0.86
R6257:Vmn2r79 UTSW 7 86,651,778 (GRCm39) missense probably benign 0.27
R6260:Vmn2r79 UTSW 7 86,686,365 (GRCm39) missense probably benign 0.00
R6307:Vmn2r79 UTSW 7 86,686,976 (GRCm39) missense probably damaging 1.00
R6323:Vmn2r79 UTSW 7 86,650,522 (GRCm39) missense probably benign 0.05
R6374:Vmn2r79 UTSW 7 86,651,498 (GRCm39) missense probably benign 0.02
R6530:Vmn2r79 UTSW 7 86,651,252 (GRCm39) missense possibly damaging 0.91
R6546:Vmn2r79 UTSW 7 86,652,741 (GRCm39) missense probably benign 0.01
R6682:Vmn2r79 UTSW 7 86,653,370 (GRCm39) missense possibly damaging 0.69
R6858:Vmn2r79 UTSW 7 86,686,580 (GRCm39) missense probably benign
R6965:Vmn2r79 UTSW 7 86,651,100 (GRCm39) missense probably benign 0.10
R7130:Vmn2r79 UTSW 7 86,651,474 (GRCm39) missense probably damaging 0.99
R7156:Vmn2r79 UTSW 7 86,686,851 (GRCm39) missense probably damaging 0.98
R7604:Vmn2r79 UTSW 7 86,652,592 (GRCm39) critical splice acceptor site probably null
R7691:Vmn2r79 UTSW 7 86,687,111 (GRCm39) missense probably damaging 0.96
R8055:Vmn2r79 UTSW 7 86,686,541 (GRCm39) missense possibly damaging 0.94
R8070:Vmn2r79 UTSW 7 86,651,336 (GRCm39) missense probably benign
R8073:Vmn2r79 UTSW 7 86,651,462 (GRCm39) missense probably benign 0.00
R8145:Vmn2r79 UTSW 7 86,686,862 (GRCm39) missense probably benign 0.02
R8263:Vmn2r79 UTSW 7 86,686,726 (GRCm39) missense possibly damaging 0.89
R8350:Vmn2r79 UTSW 7 86,686,741 (GRCm39) nonsense probably null
R8400:Vmn2r79 UTSW 7 86,651,308 (GRCm39) missense probably benign 0.00
R8862:Vmn2r79 UTSW 7 86,645,712 (GRCm39) missense probably benign 0.23
R9146:Vmn2r79 UTSW 7 86,650,681 (GRCm39) nonsense probably null
R9276:Vmn2r79 UTSW 7 86,687,045 (GRCm39) missense probably damaging 1.00
R9361:Vmn2r79 UTSW 7 86,652,822 (GRCm39) critical splice donor site probably null
R9676:Vmn2r79 UTSW 7 86,686,452 (GRCm39) missense probably damaging 1.00
U15987:Vmn2r79 UTSW 7 86,653,319 (GRCm39) missense possibly damaging 0.86
X0054:Vmn2r79 UTSW 7 86,653,270 (GRCm39) missense probably benign 0.01
Z1088:Vmn2r79 UTSW 7 86,651,549 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r79 UTSW 7 86,686,377 (GRCm39) missense probably benign
Z1176:Vmn2r79 UTSW 7 86,651,526 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCTGTGCATGGAACTCTC -3'
(R):5'- CCTCTATGATGTATGTTCCATTCAGTG -3'

Sequencing Primer
(F):5'- TCAGCAGTCTGAGATGTC -3'
(R):5'- CAGTGTAAGAATTATTACCTTCCAGG -3'
Posted On 2021-04-30