Mutagenetix > Incidental Mutation

Incidental Mutation 'R8814:Vmn2r79'

672606

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r79

Ensembl Gene

ENSMUSG00000090362

Gene Name

vomeronasal 2, receptor 79

Synonyms

EG621430

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R8814 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86996465-87037968 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 87002506 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 371 (T371S)

Ref Sequence

ENSEMBL: ENSMUSP00000132478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164462]

AlphaFold

E9Q067

Predicted Effect

probably benign
Transcript: ENSMUST00000164462
AA Change: T371S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: T371S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	75	464	1.9e-31	PFAM
Pfam:NCD3G	506	559	3.1e-21	PFAM
Pfam:7tm_3	592	827	2.8e-53	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	C	6: 129,325,604		probably benign	Het
Brd7	A	G	8: 88,345,154	V361A	probably benign	Het
C6	A	T	15: 4,792,784	Q595L	probably benign	Het
Cacna2d3	T	A	14: 29,097,815	Y532F	probably damaging	Het
Cep85l	A	T	10: 53,348,969	Y175N	probably benign	Het
Clca3a2	G	T	3: 144,797,764	N808K	probably benign	Het
Cpsf4	T	G	5: 145,178,868	S201R	probably benign	Het
Crispld2	A	G	8: 120,015,345	H144R	possibly damaging	Het
Cyp1b1	T	C	17: 79,713,359	E318G	probably benign	Het
Fam109a	G	T	5: 121,853,045	V157L	probably benign	Het
Fer1l4	A	G	2: 156,052,243	F47L	probably benign	Het
Flnb	A	G	14: 7,927,409	D1873G	probably damaging	Het
Gm47995	A	G	1: 151,198,988	M181V	probably benign	Het
Hace1	A	G	10: 45,652,701	Y346C	probably damaging	Het
Hemgn	G	T	4: 46,400,717	Q48K	possibly damaging	Het
Hhip	T	C	8: 80,051,472	D143G	probably damaging	Het
Ift74	C	T	4: 94,662,636	Q342*	probably null	Het
Kng2	A	T	16: 23,004,011	I197N	probably benign	Het
Lcat	G	A	8: 105,941,970	P167S	probably damaging	Het
Lmntd2	G	A	7: 141,210,084	R672W	probably damaging	Het
Mroh2b	G	T	15: 4,941,625	L1037F	possibly damaging	Het
Msh4	A	G	3: 153,872,320	S640P	probably damaging	Het
Mterf1b	T	C	5: 4,197,456	S366P	probably damaging	Het
Nrxn1	A	T	17: 90,630,101	C643S	probably damaging	Het
Olfr1164	T	A	2: 88,092,971	I322F	probably benign	Het
Olfr1496	T	A	19: 13,781,533	I305N	possibly damaging	Het
Olfr485	T	A	7: 108,159,065	K269N	probably benign	Het
Olfr605	A	G	7: 103,442,913	V70A	probably benign	Het
Olfr709-ps1	T	A	7: 106,926,818	I214F	probably damaging	Het
Pask	C	A	1: 93,320,585	R998L	probably benign	Het
Pcdh8	A	G	14: 79,768,897	L742P	probably benign	Het
Psma3	A	G	12: 70,978,806	E32G	probably benign	Het
Samd11	T	C	4: 156,247,884	E500G	probably benign	Het
Scarb1	A	T	5: 125,294,092	D305E	probably benign	Het
Serpinb6b	A	G	13: 32,978,304	H362R	possibly damaging	Het
Siglec1	G	A	2: 131,072,744	T1484M	probably damaging	Het
Slfn8	A	G	11: 83,016,679	V346A	possibly damaging	Het
Slitrk6	G	C	14: 110,749,938	A779G	probably benign	Het
Soga1	C	T	2: 157,030,531	W965*	probably null	Het
Sub1	A	C	15: 11,984,231	V124G	probably damaging	Het
Tbc1d32	A	G	10: 56,196,592	I277T	possibly damaging	Het
Tln2	C	A	9: 67,221,411	E1465D	possibly damaging	Het
Trappc10	A	G	10: 78,202,919	Y780H	probably damaging	Het
Trim28	T	A	7: 13,028,527	N359K	probably damaging	Het
Tspan15	G	A	10: 62,188,056	T281M	probably benign	Het
Uaca	A	G	9: 60,866,398	N396D	possibly damaging	Het
Vmn1r84	A	G	7: 12,362,458	S103P	probably damaging	Het
Vmn2r22	C	G	6: 123,637,830	R267T	probably damaging	Het
Vmn2r7	A	G	3: 64,716,563	I112T	probably benign	Het
Vmn2r70	T	A	7: 85,565,961	I122F	probably benign	Het
Vps8	T	C	16: 21,576,650	L1230P	probably damaging	Het
Zfp26	A	T	9: 20,438,434	V278D	probably benign	Het

Other mutations in Vmn2r79

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01401:Vmn2r79	APN	7	87037273	missense	probably benign	0.01
IGL01675:Vmn2r79	APN	7	86996648	missense	probably benign	0.01
IGL01760:Vmn2r79	APN	7	87002158	missense	probably benign
IGL01834:Vmn2r79	APN	7	87037146	missense	probably benign	0.01
IGL01843:Vmn2r79	APN	7	87037277	missense	probably damaging	1.00
IGL01914:Vmn2r79	APN	7	87037363	missense	probably benign	0.14
IGL01980:Vmn2r79	APN	7	87037082	missense	possibly damaging	0.49
IGL02438:Vmn2r79	APN	7	87002536	missense	probably damaging	0.98
IGL02740:Vmn2r79	APN	7	87004158	missense	probably benign	0.00
IGL03052:Vmn2r79	UTSW	7	87003591	missense	probably benign	0.00
PIT4445001:Vmn2r79	UTSW	7	87002200	missense	possibly damaging	0.46
R0096:Vmn2r79	UTSW	7	87037319	missense	probably damaging	1.00
R0096:Vmn2r79	UTSW	7	87037319	missense	probably damaging	1.00
R0270:Vmn2r79	UTSW	7	87003386	missense	probably benign	0.00
R0336:Vmn2r79	UTSW	7	87002079	missense	probably benign	0.15
R0418:Vmn2r79	UTSW	7	87002403	missense	probably benign	0.18
R1070:Vmn2r79	UTSW	7	87003473	missense	probably damaging	1.00
R1234:Vmn2r79	UTSW	7	87004099	missense	possibly damaging	0.71
R1459:Vmn2r79	UTSW	7	87037794	missense	probably benign	0.01
R1513:Vmn2r79	UTSW	7	87037444	missense	probably benign	0.01
R1624:Vmn2r79	UTSW	7	87004039	critical splice acceptor site	probably null
R1633:Vmn2r79	UTSW	7	87037834	missense	possibly damaging	0.52
R1676:Vmn2r79	UTSW	7	87002631	missense	probably benign
R1781:Vmn2r79	UTSW	7	87002347	missense	probably benign	0.00
R1794:Vmn2r79	UTSW	7	87001413	missense	probably benign	0.37
R1823:Vmn2r79	UTSW	7	87037872	missense	probably damaging	1.00
R2013:Vmn2r79	UTSW	7	87004081	missense	possibly damaging	0.50
R2018:Vmn2r79	UTSW	7	87002426	missense	probably benign	0.07
R2019:Vmn2r79	UTSW	7	87002426	missense	probably benign	0.07
R2177:Vmn2r79	UTSW	7	86996631	missense	possibly damaging	0.94
R2984:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R3719:Vmn2r79	UTSW	7	87002037	missense	probably benign	0.05
R3798:Vmn2r79	UTSW	7	87002194	missense	possibly damaging	0.88
R3969:Vmn2r79	UTSW	7	87003593	missense	probably damaging	1.00
R4182:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4183:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4245:Vmn2r79	UTSW	7	87002416	missense	possibly damaging	0.73
R4301:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4391:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4393:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4394:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4396:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4397:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4592:Vmn2r79	UTSW	7	87004111	missense	possibly damaging	0.86
R4697:Vmn2r79	UTSW	7	87037960	missense	probably damaging	0.98
R4897:Vmn2r79	UTSW	7	87001467	missense	probably benign
R5016:Vmn2r79	UTSW	7	87037340	missense	probably benign	0.00
R5058:Vmn2r79	UTSW	7	87002215	missense	probably damaging	0.98
R5177:Vmn2r79	UTSW	7	87001969	missense	probably damaging	0.97
R6078:Vmn2r79	UTSW	7	87004111	missense	possibly damaging	0.86
R6079:Vmn2r79	UTSW	7	87004111	missense	possibly damaging	0.86
R6138:Vmn2r79	UTSW	7	87004111	missense	possibly damaging	0.86
R6257:Vmn2r79	UTSW	7	87002570	missense	probably benign	0.27
R6260:Vmn2r79	UTSW	7	87037157	missense	probably benign	0.00
R6307:Vmn2r79	UTSW	7	87037768	missense	probably damaging	1.00
R6323:Vmn2r79	UTSW	7	87001314	missense	probably benign	0.05
R6374:Vmn2r79	UTSW	7	87002290	missense	probably benign	0.02
R6530:Vmn2r79	UTSW	7	87002044	missense	possibly damaging	0.91
R6546:Vmn2r79	UTSW	7	87003533	missense	probably benign	0.01
R6682:Vmn2r79	UTSW	7	87004162	missense	possibly damaging	0.69
R6858:Vmn2r79	UTSW	7	87037372	missense	probably benign
R6965:Vmn2r79	UTSW	7	87001892	missense	probably benign	0.10
R7130:Vmn2r79	UTSW	7	87002266	missense	probably damaging	0.99
R7156:Vmn2r79	UTSW	7	87037643	missense	probably damaging	0.98
R7604:Vmn2r79	UTSW	7	87003384	critical splice acceptor site	probably null
R7691:Vmn2r79	UTSW	7	87037903	missense	probably damaging	0.96
R8055:Vmn2r79	UTSW	7	87037333	missense	possibly damaging	0.94
R8070:Vmn2r79	UTSW	7	87002128	missense	probably benign
R8073:Vmn2r79	UTSW	7	87002254	missense	probably benign	0.00
R8145:Vmn2r79	UTSW	7	87037654	missense	probably benign	0.02
R8263:Vmn2r79	UTSW	7	87037518	missense	possibly damaging	0.89
R8350:Vmn2r79	UTSW	7	87037533	nonsense	probably null
R8400:Vmn2r79	UTSW	7	87002100	missense	probably benign	0.00
R8862:Vmn2r79	UTSW	7	86996504	missense	probably benign	0.23
R9146:Vmn2r79	UTSW	7	87001473	nonsense	probably null
R9276:Vmn2r79	UTSW	7	87037837	missense	probably damaging	1.00
R9361:Vmn2r79	UTSW	7	87003614	critical splice donor site	probably null
R9676:Vmn2r79	UTSW	7	87037244	missense	probably damaging	1.00
U15987:Vmn2r79	UTSW	7	87004111	missense	possibly damaging	0.86
X0054:Vmn2r79	UTSW	7	87004062	missense	probably benign	0.01
Z1088:Vmn2r79	UTSW	7	87002341	missense	probably damaging	1.00
Z1176:Vmn2r79	UTSW	7	87002318	missense	probably benign	0.00
Z1176:Vmn2r79	UTSW	7	87037169	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTCTGTGCATGGAACTCTC -3'
(R):5'- CCTCTATGATGTATGTTCCATTCAGTG -3'

Sequencing Primer
(F):5'- TCAGCAGTCTGAGATGTC -3'
(R):5'- CAGTGTAAGAATTATTACCTTCCAGG -3'

Posted On

2021-04-30