Incidental Mutation 'R8814:Olfr485'
ID 672609
Institutional Source Beutler Lab
Gene Symbol Olfr485
Ensembl Gene ENSMUSG00000108995
Gene Name olfactory receptor 485
Synonyms GA_x6K02T2PBJ9-10489044-10488091, MOR204-30P, MOR204-40_p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 108158918-108159871 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108159065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 269 (K269N)
Ref Sequence ENSEMBL: ENSMUSP00000147194 (fasta)
AlphaFold A0A140LJF5
Predicted Effect probably benign
Transcript: ENSMUST00000208296
AA Change: K269N

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
Brd7 A G 8: 88,345,154 V361A probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cacna2d3 T A 14: 29,097,815 Y532F probably damaging Het
Cep85l A T 10: 53,348,969 Y175N probably benign Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Crispld2 A G 8: 120,015,345 H144R possibly damaging Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hace1 A G 10: 45,652,701 Y346C probably damaging Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Mterf1b T C 5: 4,197,456 S366P probably damaging Het
Nrxn1 A T 17: 90,630,101 C643S probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Scarb1 A T 5: 125,294,092 D305E probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slfn8 A G 11: 83,016,679 V346A possibly damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Soga1 C T 2: 157,030,531 W965* probably null Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Uaca A G 9: 60,866,398 N396D possibly damaging Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Vps8 T C 16: 21,576,650 L1230P probably damaging Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Olfr485
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3115:Olfr485 UTSW 7 108159822 missense probably benign 0.00
R3116:Olfr485 UTSW 7 108159822 missense probably benign 0.00
R3978:Olfr485 UTSW 7 108159612 missense possibly damaging 0.52
R4722:Olfr485 UTSW 7 108159238 missense probably benign 0.04
R5337:Olfr485 UTSW 7 108159273 missense probably benign 0.01
R5553:Olfr485 UTSW 7 108159271 missense probably benign 0.02
R6258:Olfr485 UTSW 7 108158974 missense probably damaging 1.00
R6386:Olfr485 UTSW 7 108159202 missense probably damaging 1.00
R6498:Olfr485 UTSW 7 108159432 missense probably benign 0.20
R7096:Olfr485 UTSW 7 108159641 missense probably benign
R7134:Olfr485 UTSW 7 108159676 missense probably damaging 1.00
R7187:Olfr485 UTSW 7 108159378 missense probably benign 0.00
R7226:Olfr485 UTSW 7 108158957 missense probably benign 0.00
R7799:Olfr485 UTSW 7 108159430 missense probably benign 0.00
R8371:Olfr485 UTSW 7 108159228 missense probably benign
R8704:Olfr485 UTSW 7 108159504 missense possibly damaging 0.66
R9451:Olfr485 UTSW 7 108159261 missense probably benign 0.06
R9536:Olfr485 UTSW 7 108159868 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGGTTACATCGGTCTTGCAG -3'
(R):5'- AACTCTCCTGTTCTGATGTGAG -3'

Sequencing Primer
(F):5'- ACCAACAACTGGTTGCTC -3'
(R):5'- ACTGCTGGTTCGATCTCTATGAC -3'
Posted On 2021-04-30