Incidental Mutation 'R8814:Hhip'
ID 672611
Institutional Source Beutler Lab
Gene Symbol Hhip
Ensembl Gene ENSMUSG00000064325
Gene Name Hedgehog-interacting protein
Synonyms Hip1, Hip, Hhip1
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 80692480-80784635 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80778101 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 143 (D143G)
Ref Sequence ENSEMBL: ENSMUSP00000078047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079038]
AlphaFold Q7TN16
Predicted Effect probably damaging
Transcript: ENSMUST00000079038
AA Change: D143G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078047
Gene: ENSMUSG00000064325
AA Change: D143G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Folate_rec 38 220 4.9e-26 PFAM
Pfam:GSDH 226 444 3e-22 PFAM
EGF 593 635 9.63e0 SMART
EGF 638 667 2.35e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog-interacting protein (HHIP) family. The hedgehog (HH) proteins are evolutionarily conserved protein, which are important morphogens for a wide range of developmental processes, including anteroposterior patterns of limbs and regulation of left-right asymmetry in embryonic development. Multiple cell-surface receptors are responsible for transducing and/or regulating HH signals. The HHIP encoded by this gene is a highly conserved, vertebrate-specific inhibitor of HH signaling. It interacts with all three HH family members, SHH, IHH and DHH. Two single nucleotide polymorphisms (SNPs) near this gene are significantly associated with risk of chronic obstructive pulmonary disease (COPD). A single nucleotide polymorphism in this gene is also strongly associated with human height.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a reporter allele die shortly after birth due to respiratory failure, show defects in lung, spleen and pancreas morphogenesis, and exhibit small and disorganized pancreatic islets and reduced beta-cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Hhip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Hhip APN 8 80,723,412 (GRCm39) missense probably damaging 0.96
IGL02560:Hhip APN 8 80,713,638 (GRCm39) missense probably damaging 0.98
IGL03046:Hhip UTSW 8 80,698,967 (GRCm39) missense probably damaging 0.99
R0068:Hhip UTSW 8 80,715,885 (GRCm39) missense probably damaging 1.00
R0356:Hhip UTSW 8 80,724,121 (GRCm39) missense probably benign 0.20
R0707:Hhip UTSW 8 80,724,884 (GRCm39) missense probably damaging 1.00
R1163:Hhip UTSW 8 80,719,105 (GRCm39) missense probably damaging 1.00
R1583:Hhip UTSW 8 80,716,905 (GRCm39) missense probably damaging 1.00
R1900:Hhip UTSW 8 80,701,675 (GRCm39) missense probably benign 0.15
R2071:Hhip UTSW 8 80,783,931 (GRCm39) missense probably benign 0.00
R2255:Hhip UTSW 8 80,771,810 (GRCm39) missense probably damaging 0.98
R3847:Hhip UTSW 8 80,724,124 (GRCm39) missense probably benign 0.00
R4012:Hhip UTSW 8 80,719,223 (GRCm39) missense probably damaging 1.00
R4448:Hhip UTSW 8 80,770,574 (GRCm39) critical splice donor site probably null
R4607:Hhip UTSW 8 80,724,192 (GRCm39) missense probably damaging 0.99
R4608:Hhip UTSW 8 80,724,192 (GRCm39) missense probably damaging 0.99
R4677:Hhip UTSW 8 80,771,726 (GRCm39) missense probably damaging 0.96
R4738:Hhip UTSW 8 80,719,199 (GRCm39) missense probably damaging 0.98
R5040:Hhip UTSW 8 80,724,235 (GRCm39) missense probably benign 0.00
R5371:Hhip UTSW 8 80,724,220 (GRCm39) missense probably damaging 0.98
R5594:Hhip UTSW 8 80,723,492 (GRCm39) missense probably damaging 1.00
R5785:Hhip UTSW 8 80,724,821 (GRCm39) missense possibly damaging 0.84
R6026:Hhip UTSW 8 80,699,069 (GRCm39) missense probably damaging 1.00
R6259:Hhip UTSW 8 80,699,033 (GRCm39) missense probably damaging 1.00
R6782:Hhip UTSW 8 80,778,233 (GRCm39) missense probably damaging 1.00
R7105:Hhip UTSW 8 80,701,638 (GRCm39) missense probably benign 0.04
R7134:Hhip UTSW 8 80,719,142 (GRCm39) missense probably benign
R7238:Hhip UTSW 8 80,713,641 (GRCm39) missense probably benign
R7828:Hhip UTSW 8 80,724,837 (GRCm39) missense probably benign 0.00
R8418:Hhip UTSW 8 80,771,714 (GRCm39) missense probably damaging 0.99
R8947:Hhip UTSW 8 80,771,785 (GRCm39) missense probably damaging 0.97
R9101:Hhip UTSW 8 80,770,591 (GRCm39) missense probably damaging 1.00
R9163:Hhip UTSW 8 80,701,743 (GRCm39) missense probably benign 0.00
R9355:Hhip UTSW 8 80,778,233 (GRCm39) missense probably damaging 1.00
R9397:Hhip UTSW 8 80,719,112 (GRCm39) missense probably benign
R9673:Hhip UTSW 8 80,719,108 (GRCm39) missense probably damaging 1.00
R9685:Hhip UTSW 8 80,723,363 (GRCm39) missense probably damaging 1.00
X0026:Hhip UTSW 8 80,719,189 (GRCm39) missense possibly damaging 0.93
Z1177:Hhip UTSW 8 80,783,880 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTCCGTTAAACAAACCTTGAAGG -3'
(R):5'- TGCTCACATGATTGAAGGGCG -3'

Sequencing Primer
(F):5'- CCTTGAAGGACAGGGACCTTAC -3'
(R):5'- GACAGAGCTCACTTTTGCATGAC -3'
Posted On 2021-04-30