Incidental Mutation 'R8814:Brd7'
ID 672612
Institutional Source Beutler Lab
Gene Symbol Brd7
Ensembl Gene ENSMUSG00000031660
Gene Name bromodomain containing 7
Synonyms bromodomain protein 75 kDa, CELTIX1, BP75
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.762) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 88331039-88362194 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88345154 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 361 (V361A)
Ref Sequence ENSEMBL: ENSMUSP00000034085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034085]
AlphaFold O88665
Predicted Effect probably benign
Transcript: ENSMUST00000034085
AA Change: V361A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034085
Gene: ENSMUSG00000031660
AA Change: V361A

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
low complexity region 76 96 N/A INTRINSIC
BROMO 129 237 9.72e-38 SMART
Pfam:DUF3512 287 534 2.4e-93 PFAM
coiled coil region 535 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the bromodomain-containing protein family. The product of this gene has been identified as a component of one form of the SWI/SNF chromatin remodeling complex, and as a protein which interacts with p53 and is required for p53-dependent oncogene-induced senescence which prevents tumor growth. Pseudogenes have been described on chromosomes 2, 3, 6, 13 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired cognitive behavior and dendrite morphology in the medial prefrontal cortex. Mice homozygous for a different knock-out allele die in utero prior to E16.5, showing fetal growth retardation and altered limb, blood vessel and organ development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cacna2d3 T A 14: 29,097,815 Y532F probably damaging Het
Cep85l A T 10: 53,348,969 Y175N probably benign Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Crispld2 A G 8: 120,015,345 H144R possibly damaging Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hace1 A G 10: 45,652,701 Y346C probably damaging Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Mterf1b T C 5: 4,197,456 S366P probably damaging Het
Nrxn1 A T 17: 90,630,101 C643S probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr485 T A 7: 108,159,065 K269N probably benign Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Scarb1 A T 5: 125,294,092 D305E probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slfn8 A G 11: 83,016,679 V346A possibly damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Soga1 C T 2: 157,030,531 W965* probably null Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Uaca A G 9: 60,866,398 N396D possibly damaging Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Vps8 T C 16: 21,576,650 L1230P probably damaging Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Brd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Brd7 APN 8 88332875 unclassified probably benign
IGL02172:Brd7 APN 8 88351824 missense probably benign 0.41
IGL02441:Brd7 APN 8 88343590 missense probably damaging 1.00
R0241:Brd7 UTSW 8 88345850 missense probably benign 0.01
R0241:Brd7 UTSW 8 88345850 missense probably benign 0.01
R0845:Brd7 UTSW 8 88342767 nonsense probably null
R1613:Brd7 UTSW 8 88346950 missense probably benign 0.00
R1659:Brd7 UTSW 8 88333792 missense probably damaging 1.00
R1663:Brd7 UTSW 8 88358023 missense possibly damaging 0.87
R2237:Brd7 UTSW 8 88346913 missense probably benign 0.22
R2280:Brd7 UTSW 8 88342757 missense probably benign 0.00
R2916:Brd7 UTSW 8 88342780 missense probably damaging 0.98
R2917:Brd7 UTSW 8 88342780 missense probably damaging 0.98
R3770:Brd7 UTSW 8 88339407 critical splice donor site probably null
R4030:Brd7 UTSW 8 88332931 missense probably damaging 1.00
R5287:Brd7 UTSW 8 88357541 missense probably damaging 1.00
R5403:Brd7 UTSW 8 88357541 missense probably damaging 1.00
R6333:Brd7 UTSW 8 88345191 missense probably damaging 1.00
R7021:Brd7 UTSW 8 88347004 missense probably benign 0.00
R7072:Brd7 UTSW 8 88346987 missense probably benign
R7445:Brd7 UTSW 8 88361708 missense probably damaging 1.00
R7482:Brd7 UTSW 8 88361626 missense probably damaging 0.99
R7977:Brd7 UTSW 8 88334141 missense probably benign
R7987:Brd7 UTSW 8 88334141 missense probably benign
R8205:Brd7 UTSW 8 88343615 missense probably damaging 1.00
R8984:Brd7 UTSW 8 88354712 missense probably benign 0.00
R9190:Brd7 UTSW 8 88354646 missense probably damaging 1.00
R9296:Brd7 UTSW 8 88332932 missense possibly damaging 0.46
X0067:Brd7 UTSW 8 88343697 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGGCTGCACACATCTCCTC -3'
(R):5'- GTTCTGAATTAATGATGCTAGCCTGTG -3'

Sequencing Primer
(F):5'- CCACTAGGGAGTAGCTGCTATTGC -3'
(R):5'- GGCATGCATCTGATGGCTACTC -3'
Posted On 2021-04-30