Incidental Mutation 'R8814:Crispld2'
ID 672614
Institutional Source Beutler Lab
Gene Symbol Crispld2
Ensembl Gene ENSMUSG00000031825
Gene Name cysteine-rich secretory protein LCCL domain containing 2
Synonyms 1810049K24Rik, Lgl1, coffeecrisp
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 119992438-120052793 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120015345 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 144 (H144R)
Ref Sequence ENSEMBL: ENSMUSP00000034282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034282] [ENSMUST00000108972] [ENSMUST00000127664] [ENSMUST00000132583]
AlphaFold Q8BZQ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000034282
AA Change: H144R

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034282
Gene: ENSMUSG00000031825
AA Change: H144R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 284 368 1.25e-45 SMART
LCCL 385 477 1.28e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108972
AA Change: H144R

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104600
Gene: ENSMUSG00000031825
AA Change: H144R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 283 367 1.25e-45 SMART
LCCL 384 476 1.28e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000132583
AA Change: H144R

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122962
Gene: ENSMUSG00000031825
AA Change: H144R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 283 367 1.25e-45 SMART
LCCL 384 476 1.28e-51 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous mutant mice show various immunological abnormalities, enhanced glucose tolerance and decreased bone-related measurements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
Brd7 A G 8: 88,345,154 V361A probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cacna2d3 T A 14: 29,097,815 Y532F probably damaging Het
Cep85l A T 10: 53,348,969 Y175N probably benign Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hace1 A G 10: 45,652,701 Y346C probably damaging Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Mterf1b T C 5: 4,197,456 S366P probably damaging Het
Nrxn1 A T 17: 90,630,101 C643S probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr485 T A 7: 108,159,065 K269N probably benign Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Scarb1 A T 5: 125,294,092 D305E probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slfn8 A G 11: 83,016,679 V346A possibly damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Soga1 C T 2: 157,030,531 W965* probably null Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Uaca A G 9: 60,866,398 N396D possibly damaging Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Vps8 T C 16: 21,576,650 L1230P probably damaging Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Crispld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Crispld2 APN 8 120033560 missense probably damaging 1.00
IGL00835:Crispld2 APN 8 120010648 missense probably damaging 1.00
IGL03209:Crispld2 APN 8 120031098 missense possibly damaging 0.88
IGL03324:Crispld2 APN 8 120015371 missense probably damaging 1.00
R0172:Crispld2 UTSW 8 120026071 missense possibly damaging 0.80
R0212:Crispld2 UTSW 8 120010631 missense probably benign
R0492:Crispld2 UTSW 8 120026067 missense probably benign 0.30
R1532:Crispld2 UTSW 8 120023572 missense probably benign
R1715:Crispld2 UTSW 8 120023649 missense possibly damaging 0.75
R1865:Crispld2 UTSW 8 120010567 missense probably benign 0.00
R1953:Crispld2 UTSW 8 120015296 missense probably damaging 1.00
R2161:Crispld2 UTSW 8 120015339 missense probably damaging 1.00
R2306:Crispld2 UTSW 8 120026071 missense probably damaging 0.99
R2851:Crispld2 UTSW 8 120014089 missense probably damaging 1.00
R3774:Crispld2 UTSW 8 120029266 missense probably damaging 0.99
R3776:Crispld2 UTSW 8 120029266 missense probably damaging 0.99
R6044:Crispld2 UTSW 8 120010671 missense possibly damaging 0.66
R6485:Crispld2 UTSW 8 120029309 missense probably damaging 0.99
R6861:Crispld2 UTSW 8 120026113 missense probably damaging 1.00
R7792:Crispld2 UTSW 8 120031070 missense probably benign 0.01
R9129:Crispld2 UTSW 8 120010749 missense possibly damaging 0.78
R9665:Crispld2 UTSW 8 120033577 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCACTCTTCAGACACTCAGTTTG -3'
(R):5'- AGTGTGCTCTGAGACAAACGG -3'

Sequencing Primer
(F):5'- CAGACACTCAGTTTGTAAGATATGTC -3'
(R):5'- TGCTCTGAGACAAACGGAATTAAAGC -3'
Posted On 2021-04-30