Incidental Mutation 'R8814:Uaca'
ID 672616
Institutional Source Beutler Lab
Gene Symbol Uaca
Ensembl Gene ENSMUSG00000034485
Gene Name uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms 2700059D02Rik, nucling
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.179) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 60794542-60880370 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60866398 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 396 (N396D)
Ref Sequence ENSEMBL: ENSMUSP00000062047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000050183
AA Change: N396D

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: N396D

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
ANK 35 68 2.66e3 SMART
ANK 69 98 1.96e-3 SMART
ANK 102 131 1.65e-1 SMART
ANK 135 164 1.38e-3 SMART
ANK 168 197 3.65e-3 SMART
ANK 201 230 6.26e-2 SMART
Blast:ANK 234 263 7e-9 BLAST
coiled coil region 301 381 N/A INTRINSIC
coiled coil region 445 626 N/A INTRINSIC
Pfam:TolA_bind_tri 869 943 4e-11 PFAM
coiled coil region 1009 1382 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000214354
AA Change: N394D

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
Brd7 A G 8: 88,345,154 V361A probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cacna2d3 T A 14: 29,097,815 Y532F probably damaging Het
Cep85l A T 10: 53,348,969 Y175N probably benign Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Crispld2 A G 8: 120,015,345 H144R possibly damaging Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hace1 A G 10: 45,652,701 Y346C probably damaging Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Mterf1b T C 5: 4,197,456 S366P probably damaging Het
Nrxn1 A T 17: 90,630,101 C643S probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr485 T A 7: 108,159,065 K269N probably benign Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Scarb1 A T 5: 125,294,092 D305E probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slfn8 A G 11: 83,016,679 V346A possibly damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Soga1 C T 2: 157,030,531 W965* probably null Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Vps8 T C 16: 21,576,650 L1230P probably damaging Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Uaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Uaca APN 9 60872225 missense probably benign
IGL01751:Uaca APN 9 60869857 missense probably damaging 1.00
IGL02868:Uaca APN 9 60863637 missense probably damaging 1.00
IGL02977:Uaca APN 9 60866380 missense probably benign 0.00
IGL03037:Uaca APN 9 60840865 missense probably damaging 1.00
IGL03060:Uaca APN 9 60869866 missense probably damaging 1.00
IGL03083:Uaca APN 9 60863663 missense probably benign 0.28
IGL03266:Uaca APN 9 60863407 missense probably damaging 1.00
IGL03346:Uaca APN 9 60854318 missense probably damaging 1.00
Ixtapa UTSW 9 60870413 missense probably damaging 0.99
oaxaca UTSW 9 60871451 missense probably benign
R0408:Uaca UTSW 9 60871859 missense possibly damaging 0.71
R0567:Uaca UTSW 9 60871381 missense probably benign 0.01
R0598:Uaca UTSW 9 60870921 nonsense probably null
R0603:Uaca UTSW 9 60871097 missense possibly damaging 0.60
R0655:Uaca UTSW 9 60872029 missense probably benign 0.03
R0707:Uaca UTSW 9 60848618 splice site probably benign
R0791:Uaca UTSW 9 60872059 missense possibly damaging 0.50
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1520:Uaca UTSW 9 60871381 missense probably benign 0.30
R1673:Uaca UTSW 9 60872156 missense probably damaging 1.00
R1894:Uaca UTSW 9 60870436 missense possibly damaging 0.87
R1997:Uaca UTSW 9 60870341 missense probably damaging 1.00
R2042:Uaca UTSW 9 60869891 missense probably damaging 1.00
R2095:Uaca UTSW 9 60840843 missense probably benign 0.00
R2148:Uaca UTSW 9 60869679 missense probably damaging 1.00
R2384:Uaca UTSW 9 60869917 missense probably damaging 1.00
R3110:Uaca UTSW 9 60871499 missense probably damaging 1.00
R3112:Uaca UTSW 9 60871499 missense probably damaging 1.00
R4001:Uaca UTSW 9 60871084 missense probably benign 0.04
R4155:Uaca UTSW 9 60871753 missense probably benign 0.02
R4156:Uaca UTSW 9 60871753 missense probably benign 0.02
R4157:Uaca UTSW 9 60871753 missense probably benign 0.02
R4410:Uaca UTSW 9 60869891 missense probably damaging 1.00
R4674:Uaca UTSW 9 60854429 missense possibly damaging 0.94
R4871:Uaca UTSW 9 60846001 missense probably damaging 1.00
R5130:Uaca UTSW 9 60880228 missense probably damaging 0.96
R5328:Uaca UTSW 9 60870532 missense probably benign 0.44
R5358:Uaca UTSW 9 60871148 missense probably benign
R5415:Uaca UTSW 9 60870139 missense possibly damaging 0.65
R5437:Uaca UTSW 9 60871451 missense probably benign
R5647:Uaca UTSW 9 60872098 missense probably benign 0.28
R5710:Uaca UTSW 9 60871811 missense probably damaging 1.00
R5920:Uaca UTSW 9 60869603 missense probably benign 0.19
R5931:Uaca UTSW 9 60872012 missense probably damaging 0.97
R5933:Uaca UTSW 9 60840956 missense probably damaging 1.00
R5959:Uaca UTSW 9 60870770 missense probably damaging 1.00
R6193:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6195:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6242:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6243:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6244:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6274:Uaca UTSW 9 60850291 splice site probably null
R6670:Uaca UTSW 9 60872024 missense probably benign 0.09
R6883:Uaca UTSW 9 60869891 missense probably damaging 1.00
R7011:Uaca UTSW 9 60870368 missense probably damaging 1.00
R7111:Uaca UTSW 9 60871838 missense probably benign 0.06
R7146:Uaca UTSW 9 60870413 missense probably damaging 0.99
R7424:Uaca UTSW 9 60870110 missense probably damaging 1.00
R7485:Uaca UTSW 9 60846000 missense probably damaging 1.00
R7510:Uaca UTSW 9 60850205 splice site probably null
R7688:Uaca UTSW 9 60874127 missense probably benign 0.11
R7724:Uaca UTSW 9 60869905 missense probably benign 0.24
R7743:Uaca UTSW 9 60876395 missense probably damaging 0.99
R8556:Uaca UTSW 9 60870641 missense probably damaging 0.97
R8699:Uaca UTSW 9 60871065 missense probably damaging 1.00
R8828:Uaca UTSW 9 60871570 missense probably benign 0.00
R9475:Uaca UTSW 9 60872216 missense possibly damaging 0.88
R9477:Uaca UTSW 9 60870826 missense probably benign 0.33
R9509:Uaca UTSW 9 60872216 missense possibly damaging 0.88
X0067:Uaca UTSW 9 60859149 missense possibly damaging 0.69
Z1177:Uaca UTSW 9 60874123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGTGCTTAGAGAAGTGCTG -3'
(R):5'- GTGCCTACCACATTTCACCAGG -3'

Sequencing Primer
(F):5'- CTTAGAGAAGTGCTGGGTCCAG -3'
(R):5'- ATTTCACCAGGGGCCACAGTG -3'
Posted On 2021-04-30