Incidental Mutation 'R8814:Uaca'
ID 672616
Institutional Source Beutler Lab
Gene Symbol Uaca
Ensembl Gene ENSMUSG00000034485
Gene Name uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms nucling, 2700059D02Rik
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 60701824-60787652 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60773680 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 396 (N396D)
Ref Sequence ENSEMBL: ENSMUSP00000062047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000050183
AA Change: N396D

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: N396D

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
ANK 35 68 2.66e3 SMART
ANK 69 98 1.96e-3 SMART
ANK 102 131 1.65e-1 SMART
ANK 135 164 1.38e-3 SMART
ANK 168 197 3.65e-3 SMART
ANK 201 230 6.26e-2 SMART
Blast:ANK 234 263 7e-9 BLAST
coiled coil region 301 381 N/A INTRINSIC
coiled coil region 445 626 N/A INTRINSIC
Pfam:TolA_bind_tri 869 943 4e-11 PFAM
coiled coil region 1009 1382 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000214354
AA Change: N394D

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Uaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Uaca APN 9 60,779,507 (GRCm39) missense probably benign
IGL01751:Uaca APN 9 60,777,139 (GRCm39) missense probably damaging 1.00
IGL02868:Uaca APN 9 60,770,919 (GRCm39) missense probably damaging 1.00
IGL02977:Uaca APN 9 60,773,662 (GRCm39) missense probably benign 0.00
IGL03037:Uaca APN 9 60,748,147 (GRCm39) missense probably damaging 1.00
IGL03060:Uaca APN 9 60,777,148 (GRCm39) missense probably damaging 1.00
IGL03083:Uaca APN 9 60,770,945 (GRCm39) missense probably benign 0.28
IGL03266:Uaca APN 9 60,770,689 (GRCm39) missense probably damaging 1.00
IGL03346:Uaca APN 9 60,761,600 (GRCm39) missense probably damaging 1.00
Ixtapa UTSW 9 60,777,695 (GRCm39) missense probably damaging 0.99
oaxaca UTSW 9 60,778,733 (GRCm39) missense probably benign
R0408:Uaca UTSW 9 60,779,141 (GRCm39) missense possibly damaging 0.71
R0567:Uaca UTSW 9 60,778,663 (GRCm39) missense probably benign 0.01
R0598:Uaca UTSW 9 60,778,203 (GRCm39) nonsense probably null
R0603:Uaca UTSW 9 60,778,379 (GRCm39) missense possibly damaging 0.60
R0655:Uaca UTSW 9 60,779,311 (GRCm39) missense probably benign 0.03
R0707:Uaca UTSW 9 60,755,900 (GRCm39) splice site probably benign
R0791:Uaca UTSW 9 60,779,341 (GRCm39) missense possibly damaging 0.50
R1466:Uaca UTSW 9 60,761,603 (GRCm39) missense possibly damaging 0.88
R1466:Uaca UTSW 9 60,761,603 (GRCm39) missense possibly damaging 0.88
R1520:Uaca UTSW 9 60,778,663 (GRCm39) missense probably benign 0.30
R1673:Uaca UTSW 9 60,779,438 (GRCm39) missense probably damaging 1.00
R1894:Uaca UTSW 9 60,777,718 (GRCm39) missense possibly damaging 0.87
R1997:Uaca UTSW 9 60,777,623 (GRCm39) missense probably damaging 1.00
R2042:Uaca UTSW 9 60,777,173 (GRCm39) missense probably damaging 1.00
R2095:Uaca UTSW 9 60,748,125 (GRCm39) missense probably benign 0.00
R2148:Uaca UTSW 9 60,776,961 (GRCm39) missense probably damaging 1.00
R2384:Uaca UTSW 9 60,777,199 (GRCm39) missense probably damaging 1.00
R3110:Uaca UTSW 9 60,778,781 (GRCm39) missense probably damaging 1.00
R3112:Uaca UTSW 9 60,778,781 (GRCm39) missense probably damaging 1.00
R4001:Uaca UTSW 9 60,778,366 (GRCm39) missense probably benign 0.04
R4155:Uaca UTSW 9 60,779,035 (GRCm39) missense probably benign 0.02
R4156:Uaca UTSW 9 60,779,035 (GRCm39) missense probably benign 0.02
R4157:Uaca UTSW 9 60,779,035 (GRCm39) missense probably benign 0.02
R4410:Uaca UTSW 9 60,777,173 (GRCm39) missense probably damaging 1.00
R4674:Uaca UTSW 9 60,761,711 (GRCm39) missense possibly damaging 0.94
R4871:Uaca UTSW 9 60,753,283 (GRCm39) missense probably damaging 1.00
R5130:Uaca UTSW 9 60,787,510 (GRCm39) missense probably damaging 0.96
R5328:Uaca UTSW 9 60,777,814 (GRCm39) missense probably benign 0.44
R5358:Uaca UTSW 9 60,778,430 (GRCm39) missense probably benign
R5415:Uaca UTSW 9 60,777,421 (GRCm39) missense possibly damaging 0.65
R5437:Uaca UTSW 9 60,778,733 (GRCm39) missense probably benign
R5647:Uaca UTSW 9 60,779,380 (GRCm39) missense probably benign 0.28
R5710:Uaca UTSW 9 60,779,093 (GRCm39) missense probably damaging 1.00
R5920:Uaca UTSW 9 60,776,885 (GRCm39) missense probably benign 0.19
R5931:Uaca UTSW 9 60,779,294 (GRCm39) missense probably damaging 0.97
R5933:Uaca UTSW 9 60,748,238 (GRCm39) missense probably damaging 1.00
R5959:Uaca UTSW 9 60,778,052 (GRCm39) missense probably damaging 1.00
R6193:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6195:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6242:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6243:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6244:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6274:Uaca UTSW 9 60,757,573 (GRCm39) splice site probably null
R6670:Uaca UTSW 9 60,779,306 (GRCm39) missense probably benign 0.09
R6883:Uaca UTSW 9 60,777,173 (GRCm39) missense probably damaging 1.00
R7011:Uaca UTSW 9 60,777,650 (GRCm39) missense probably damaging 1.00
R7111:Uaca UTSW 9 60,779,120 (GRCm39) missense probably benign 0.06
R7146:Uaca UTSW 9 60,777,695 (GRCm39) missense probably damaging 0.99
R7424:Uaca UTSW 9 60,777,392 (GRCm39) missense probably damaging 1.00
R7485:Uaca UTSW 9 60,753,282 (GRCm39) missense probably damaging 1.00
R7510:Uaca UTSW 9 60,757,487 (GRCm39) splice site probably null
R7688:Uaca UTSW 9 60,781,409 (GRCm39) missense probably benign 0.11
R7724:Uaca UTSW 9 60,777,187 (GRCm39) missense probably benign 0.24
R7743:Uaca UTSW 9 60,783,677 (GRCm39) missense probably damaging 0.99
R8556:Uaca UTSW 9 60,777,923 (GRCm39) missense probably damaging 0.97
R8699:Uaca UTSW 9 60,778,347 (GRCm39) missense probably damaging 1.00
R8828:Uaca UTSW 9 60,778,852 (GRCm39) missense probably benign 0.00
R9475:Uaca UTSW 9 60,779,498 (GRCm39) missense possibly damaging 0.88
R9477:Uaca UTSW 9 60,778,108 (GRCm39) missense probably benign 0.33
R9509:Uaca UTSW 9 60,779,498 (GRCm39) missense possibly damaging 0.88
X0067:Uaca UTSW 9 60,766,431 (GRCm39) missense possibly damaging 0.69
Z1177:Uaca UTSW 9 60,781,405 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGTGCTTAGAGAAGTGCTG -3'
(R):5'- GTGCCTACCACATTTCACCAGG -3'

Sequencing Primer
(F):5'- CTTAGAGAAGTGCTGGGTCCAG -3'
(R):5'- ATTTCACCAGGGGCCACAGTG -3'
Posted On 2021-04-30