Incidental Mutation 'R8814:Tln2'
ID 672617
Institutional Source Beutler Lab
Gene Symbol Tln2
Ensembl Gene ENSMUSG00000052698
Gene Name talin 2
Synonyms
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.185) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 67124369-67466985 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 67128693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1465 (E1465D)
Ref Sequence ENSEMBL: ENSMUSP00000149474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215267] [ENSMUST00000215784] [ENSMUST00000217550]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000039662
AA Change: E2536D

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: E2536D

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 3.4e-59 PFAM
Pfam:I_LWEQ 661 765 1.9e-10 PFAM
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 2.6e-67 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2384 2531 2.5e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000040025
AA Change: E2536D

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: E2536D

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 8.5e-78 PFAM
low complexity region 674 693 N/A INTRINSIC
internal_repeat_2 703 763 2.05e-7 PROSPERO
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 9.9e-72 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2383 2533 4.3e-51 PFAM
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000215267
AA Change: E1446D

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215784
AA Change: E2538D

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217550
AA Change: E1465D

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Tln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tln2 APN 9 67,251,469 (GRCm39) missense possibly damaging 0.59
IGL01110:Tln2 APN 9 67,157,864 (GRCm39) nonsense probably null
IGL01112:Tln2 APN 9 67,219,093 (GRCm39) missense probably damaging 1.00
IGL01307:Tln2 APN 9 67,302,749 (GRCm39) missense probably benign 0.25
IGL01374:Tln2 APN 9 67,169,205 (GRCm39) missense probably damaging 1.00
IGL01625:Tln2 APN 9 67,277,905 (GRCm39) missense probably damaging 1.00
IGL01865:Tln2 APN 9 67,157,896 (GRCm39) nonsense probably null
IGL01999:Tln2 APN 9 67,299,787 (GRCm39) missense possibly damaging 0.81
IGL02002:Tln2 APN 9 67,263,980 (GRCm39) missense probably damaging 0.98
IGL02005:Tln2 APN 9 67,299,787 (GRCm39) missense possibly damaging 0.81
IGL02015:Tln2 APN 9 67,268,721 (GRCm39) splice site probably benign
IGL02368:Tln2 APN 9 67,148,092 (GRCm39) splice site probably benign
IGL02444:Tln2 APN 9 67,165,874 (GRCm39) splice site probably benign
IGL02646:Tln2 APN 9 67,163,278 (GRCm39) missense probably benign 0.43
IGL02744:Tln2 APN 9 67,136,658 (GRCm39) nonsense probably null
IGL02869:Tln2 APN 9 67,128,807 (GRCm39) splice site probably benign
IGL02930:Tln2 APN 9 67,300,944 (GRCm39) nonsense probably null
IGL03100:Tln2 APN 9 67,203,019 (GRCm39) missense probably damaging 1.00
IGL03326:Tln2 APN 9 67,241,539 (GRCm39) missense possibly damaging 0.67
Harrier UTSW 9 67,237,834 (GRCm39) nonsense probably null
Marsh UTSW 9 67,179,936 (GRCm39) missense probably benign 0.19
BB008:Tln2 UTSW 9 67,165,742 (GRCm39) critical splice donor site probably null
BB018:Tln2 UTSW 9 67,165,742 (GRCm39) critical splice donor site probably null
R0047:Tln2 UTSW 9 67,147,954 (GRCm39) splice site probably benign
R0047:Tln2 UTSW 9 67,147,954 (GRCm39) splice site probably benign
R0107:Tln2 UTSW 9 67,277,988 (GRCm39) missense probably damaging 1.00
R0494:Tln2 UTSW 9 67,262,479 (GRCm39) missense probably benign 0.22
R0884:Tln2 UTSW 9 67,278,015 (GRCm39) missense probably damaging 1.00
R0947:Tln2 UTSW 9 67,203,095 (GRCm39) missense probably benign 0.08
R0989:Tln2 UTSW 9 67,136,736 (GRCm39) missense probably damaging 1.00
R1195:Tln2 UTSW 9 67,165,848 (GRCm39) missense probably damaging 0.96
R1195:Tln2 UTSW 9 67,165,848 (GRCm39) missense probably damaging 0.96
R1195:Tln2 UTSW 9 67,165,848 (GRCm39) missense probably damaging 0.96
R1486:Tln2 UTSW 9 67,219,121 (GRCm39) missense probably damaging 1.00
R1527:Tln2 UTSW 9 67,179,950 (GRCm39) missense possibly damaging 0.95
R1584:Tln2 UTSW 9 67,203,696 (GRCm39) missense probably damaging 1.00
R1636:Tln2 UTSW 9 67,213,814 (GRCm39) missense probably damaging 1.00
R1656:Tln2 UTSW 9 67,134,389 (GRCm39) missense possibly damaging 0.81
R1707:Tln2 UTSW 9 67,283,089 (GRCm39) missense probably benign 0.00
R1749:Tln2 UTSW 9 67,193,796 (GRCm39) missense probably benign 0.01
R1751:Tln2 UTSW 9 67,193,796 (GRCm39) missense probably benign 0.01
R1761:Tln2 UTSW 9 67,193,796 (GRCm39) missense probably benign 0.01
R1767:Tln2 UTSW 9 67,193,796 (GRCm39) missense probably benign 0.01
R1815:Tln2 UTSW 9 67,136,705 (GRCm39) missense probably damaging 1.00
R1840:Tln2 UTSW 9 67,249,325 (GRCm39) missense probably damaging 1.00
R1847:Tln2 UTSW 9 67,269,969 (GRCm39) nonsense probably null
R1964:Tln2 UTSW 9 67,249,417 (GRCm39) missense probably benign 0.00
R1968:Tln2 UTSW 9 67,163,183 (GRCm39) missense probably damaging 1.00
R2036:Tln2 UTSW 9 67,179,986 (GRCm39) missense possibly damaging 0.76
R2038:Tln2 UTSW 9 67,304,935 (GRCm39) start codon destroyed probably benign 0.01
R2152:Tln2 UTSW 9 67,209,842 (GRCm39) missense probably damaging 1.00
R2153:Tln2 UTSW 9 67,209,842 (GRCm39) missense probably damaging 1.00
R2154:Tln2 UTSW 9 67,209,842 (GRCm39) missense probably damaging 1.00
R2191:Tln2 UTSW 9 67,262,503 (GRCm39) missense probably damaging 1.00
R2192:Tln2 UTSW 9 67,262,503 (GRCm39) missense probably damaging 1.00
R2201:Tln2 UTSW 9 67,283,039 (GRCm39) missense probably damaging 1.00
R3116:Tln2 UTSW 9 67,262,421 (GRCm39) missense probably benign 0.10
R3151:Tln2 UTSW 9 67,237,829 (GRCm39) critical splice donor site probably null
R3795:Tln2 UTSW 9 67,163,197 (GRCm39) missense probably damaging 0.97
R3953:Tln2 UTSW 9 67,277,911 (GRCm39) missense probably damaging 1.00
R4450:Tln2 UTSW 9 67,251,347 (GRCm39) critical splice donor site probably null
R4685:Tln2 UTSW 9 67,209,854 (GRCm39) missense probably damaging 1.00
R4688:Tln2 UTSW 9 67,304,935 (GRCm39) start codon destroyed probably benign 0.01
R4696:Tln2 UTSW 9 67,302,743 (GRCm39) missense probably damaging 1.00
R4697:Tln2 UTSW 9 67,302,743 (GRCm39) missense probably damaging 1.00
R4700:Tln2 UTSW 9 67,253,809 (GRCm39) missense probably benign 0.03
R4701:Tln2 UTSW 9 67,253,809 (GRCm39) missense probably benign 0.03
R4741:Tln2 UTSW 9 67,293,837 (GRCm39) critical splice donor site probably null
R4806:Tln2 UTSW 9 67,239,015 (GRCm39) missense probably benign 0.29
R4807:Tln2 UTSW 9 67,239,015 (GRCm39) missense probably benign 0.29
R4808:Tln2 UTSW 9 67,239,015 (GRCm39) missense probably benign 0.29
R4967:Tln2 UTSW 9 67,262,407 (GRCm39) missense probably damaging 0.97
R5061:Tln2 UTSW 9 67,261,750 (GRCm39) missense probably benign
R5092:Tln2 UTSW 9 67,163,310 (GRCm39) missense probably benign 0.13
R5093:Tln2 UTSW 9 67,241,596 (GRCm39) missense probably benign 0.44
R5126:Tln2 UTSW 9 67,165,817 (GRCm39) missense probably damaging 1.00
R5204:Tln2 UTSW 9 67,261,764 (GRCm39) missense probably benign 0.00
R5236:Tln2 UTSW 9 67,273,205 (GRCm39) missense probably damaging 0.99
R5287:Tln2 UTSW 9 67,149,641 (GRCm39) missense probably damaging 1.00
R5568:Tln2 UTSW 9 67,219,147 (GRCm39) missense probably damaging 1.00
R5571:Tln2 UTSW 9 67,241,602 (GRCm39) missense possibly damaging 0.88
R5642:Tln2 UTSW 9 67,203,640 (GRCm39) missense probably benign 0.01
R5711:Tln2 UTSW 9 67,299,829 (GRCm39) missense probably benign 0.00
R5776:Tln2 UTSW 9 67,165,532 (GRCm39) missense probably damaging 1.00
R5791:Tln2 UTSW 9 67,293,887 (GRCm39) missense probably damaging 0.98
R5866:Tln2 UTSW 9 67,174,150 (GRCm39) missense probably damaging 1.00
R5888:Tln2 UTSW 9 67,136,685 (GRCm39) missense probably damaging 1.00
R5902:Tln2 UTSW 9 67,269,999 (GRCm39) missense probably benign 0.02
R6106:Tln2 UTSW 9 67,230,302 (GRCm39) missense probably damaging 0.99
R6175:Tln2 UTSW 9 67,131,363 (GRCm39) missense probably damaging 1.00
R6385:Tln2 UTSW 9 67,185,411 (GRCm39) missense probably benign 0.45
R6430:Tln2 UTSW 9 67,179,947 (GRCm39) missense probably damaging 1.00
R6441:Tln2 UTSW 9 67,179,971 (GRCm39) missense probably damaging 1.00
R6738:Tln2 UTSW 9 67,293,946 (GRCm39) missense possibly damaging 0.91
R6776:Tln2 UTSW 9 67,170,187 (GRCm39) missense probably damaging 1.00
R6794:Tln2 UTSW 9 67,193,840 (GRCm39) missense probably benign 0.07
R6850:Tln2 UTSW 9 67,165,817 (GRCm39) missense probably damaging 1.00
R6907:Tln2 UTSW 9 67,304,917 (GRCm39) missense probably damaging 0.98
R6909:Tln2 UTSW 9 67,299,814 (GRCm39) missense probably damaging 0.97
R6951:Tln2 UTSW 9 67,165,767 (GRCm39) missense probably damaging 0.97
R7015:Tln2 UTSW 9 67,269,929 (GRCm39) missense possibly damaging 0.55
R7051:Tln2 UTSW 9 67,253,699 (GRCm39) missense probably benign 0.00
R7246:Tln2 UTSW 9 67,170,261 (GRCm39) missense probably damaging 1.00
R7292:Tln2 UTSW 9 67,253,743 (GRCm39) missense probably benign
R7753:Tln2 UTSW 9 67,302,755 (GRCm39) missense probably damaging 1.00
R7868:Tln2 UTSW 9 67,255,508 (GRCm39) missense probably damaging 1.00
R7931:Tln2 UTSW 9 67,165,742 (GRCm39) critical splice donor site probably null
R8023:Tln2 UTSW 9 67,131,346 (GRCm39) missense probably damaging 1.00
R8081:Tln2 UTSW 9 67,264,029 (GRCm39) missense probably damaging 1.00
R8164:Tln2 UTSW 9 67,226,702 (GRCm39) missense probably benign 0.31
R8192:Tln2 UTSW 9 67,253,811 (GRCm39) nonsense probably null
R8495:Tln2 UTSW 9 67,261,749 (GRCm39) missense probably benign 0.01
R8734:Tln2 UTSW 9 67,179,936 (GRCm39) missense probably benign 0.19
R8739:Tln2 UTSW 9 67,165,555 (GRCm39) missense probably damaging 1.00
R8757:Tln2 UTSW 9 67,274,500 (GRCm39) missense probably damaging 1.00
R8759:Tln2 UTSW 9 67,274,500 (GRCm39) missense probably damaging 1.00
R8770:Tln2 UTSW 9 67,230,304 (GRCm39) missense probably benign
R8781:Tln2 UTSW 9 67,163,233 (GRCm39) missense probably damaging 1.00
R8812:Tln2 UTSW 9 67,128,693 (GRCm39) missense possibly damaging 0.75
R8816:Tln2 UTSW 9 67,128,799 (GRCm39) missense probably damaging 1.00
R8816:Tln2 UTSW 9 67,128,693 (GRCm39) missense possibly damaging 0.75
R8833:Tln2 UTSW 9 67,128,693 (GRCm39) missense possibly damaging 0.75
R8835:Tln2 UTSW 9 67,304,975 (GRCm39) splice site probably benign
R8837:Tln2 UTSW 9 67,157,866 (GRCm39) missense probably damaging 0.99
R8843:Tln2 UTSW 9 67,302,827 (GRCm39) missense probably damaging 1.00
R8864:Tln2 UTSW 9 67,237,834 (GRCm39) nonsense probably null
R8867:Tln2 UTSW 9 67,237,832 (GRCm39) missense probably damaging 0.98
R8921:Tln2 UTSW 9 67,174,105 (GRCm39) missense probably damaging 0.99
R9080:Tln2 UTSW 9 67,253,843 (GRCm39) missense probably damaging 1.00
R9083:Tln2 UTSW 9 67,269,927 (GRCm39) missense probably damaging 0.96
R9150:Tln2 UTSW 9 67,128,778 (GRCm39) missense probably damaging 1.00
R9287:Tln2 UTSW 9 67,277,980 (GRCm39) missense probably benign 0.20
R9330:Tln2 UTSW 9 67,229,213 (GRCm39) missense possibly damaging 0.61
R9343:Tln2 UTSW 9 67,230,353 (GRCm39) missense probably benign 0.10
R9355:Tln2 UTSW 9 67,262,529 (GRCm39) missense possibly damaging 0.46
R9383:Tln2 UTSW 9 67,278,043 (GRCm39) missense probably benign 0.17
R9386:Tln2 UTSW 9 67,273,249 (GRCm39) missense possibly damaging 0.78
R9407:Tln2 UTSW 9 67,136,732 (GRCm39) missense probably damaging 1.00
R9483:Tln2 UTSW 9 67,299,769 (GRCm39) missense probably damaging 1.00
R9523:Tln2 UTSW 9 67,165,766 (GRCm39) missense probably damaging 0.99
R9642:Tln2 UTSW 9 67,157,826 (GRCm39) missense probably benign 0.02
R9703:Tln2 UTSW 9 67,293,938 (GRCm39) missense probably damaging 1.00
X0027:Tln2 UTSW 9 67,284,135 (GRCm39) missense probably damaging 1.00
X0064:Tln2 UTSW 9 67,255,420 (GRCm39) missense probably damaging 1.00
X0067:Tln2 UTSW 9 67,277,973 (GRCm39) missense probably damaging 1.00
Z1176:Tln2 UTSW 9 67,253,767 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CTGAGATATAGCGAGGCGTG -3'
(R):5'- TCATCTGCGTCCATCACCAG -3'

Sequencing Primer
(F):5'- ACTGTACCGTGTGAGACCATGATC -3'
(R):5'- ATCACCAGAGGGGCTGTG -3'
Posted On 2021-04-30