Incidental Mutation 'R8814:Hace1'
ID 672618
Institutional Source Beutler Lab
Gene Symbol Hace1
Ensembl Gene ENSMUSG00000038822
Gene Name HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
Synonyms A730034A22Rik, 1700042J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 45577829-45712345 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45652701 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 346 (Y346C)
Ref Sequence ENSEMBL: ENSMUSP00000039206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037044]
AlphaFold Q3U0D9
Predicted Effect probably damaging
Transcript: ENSMUST00000037044
AA Change: Y346C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039206
Gene: ENSMUSG00000038822
AA Change: Y346C

DomainStartEndE-ValueType
ANK 64 93 3.23e-4 SMART
ANK 97 126 7.76e-7 SMART
ANK 130 159 8.26e-2 SMART
ANK 163 192 1.94e-7 SMART
ANK 196 227 1.65e-1 SMART
ANK 228 257 5.98e1 SMART
Blast:HECTc 372 522 7e-87 BLAST
HECTc 572 909 1.76e-138 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HECT domain and ankyrin repeat-containing ubiquitin ligase. The encoded protein is involved in specific tagging of target proteins, leading to their subcellular localization or proteasomal degradation. The protein is a potential tumor suppressor and is involved in the pathophysiology of several tumors, including Wilm's tumor. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased spontaneous and induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
Brd7 A G 8: 88,345,154 V361A probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cacna2d3 T A 14: 29,097,815 Y532F probably damaging Het
Cep85l A T 10: 53,348,969 Y175N probably benign Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Crispld2 A G 8: 120,015,345 H144R possibly damaging Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Mterf1b T C 5: 4,197,456 S366P probably damaging Het
Nrxn1 A T 17: 90,630,101 C643S probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr485 T A 7: 108,159,065 K269N probably benign Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Scarb1 A T 5: 125,294,092 D305E probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slfn8 A G 11: 83,016,679 V346A possibly damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Soga1 C T 2: 157,030,531 W965* probably null Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Uaca A G 9: 60,866,398 N396D possibly damaging Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Vps8 T C 16: 21,576,650 L1230P probably damaging Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Hace1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Hace1 APN 10 45672357 nonsense probably null
IGL01456:Hace1 APN 10 45709998 splice site probably benign
IGL02122:Hace1 APN 10 45618604 missense probably damaging 1.00
IGL02217:Hace1 APN 10 45590375 splice site probably null
IGL02493:Hace1 APN 10 45588419 missense probably damaging 0.98
IGL02596:Hace1 APN 10 45700640 missense possibly damaging 0.55
IGL02619:Hace1 APN 10 45671434 unclassified probably benign
IGL03163:Hace1 APN 10 45672605 missense probably damaging 0.97
R0609:Hace1 UTSW 10 45648869 missense probably damaging 1.00
R0853:Hace1 UTSW 10 45648683 missense probably damaging 1.00
R2038:Hace1 UTSW 10 45700625 missense probably benign 0.03
R2212:Hace1 UTSW 10 45648675 missense possibly damaging 0.50
R2328:Hace1 UTSW 10 45648945 missense probably benign 0.43
R2881:Hace1 UTSW 10 45671134 missense probably benign 0.10
R3005:Hace1 UTSW 10 45648863 missense probably damaging 0.96
R3414:Hace1 UTSW 10 45648675 missense possibly damaging 0.50
R3930:Hace1 UTSW 10 45711508 missense probably benign 0.37
R4014:Hace1 UTSW 10 45588374 splice site probably benign
R4335:Hace1 UTSW 10 45709961 missense probably damaging 0.99
R4547:Hace1 UTSW 10 45672555 splice site probably null
R4812:Hace1 UTSW 10 45686603 missense probably benign 0.00
R4996:Hace1 UTSW 10 45649950 missense probably benign 0.17
R5858:Hace1 UTSW 10 45711525 missense possibly damaging 0.58
R5995:Hace1 UTSW 10 45670391 missense probably benign 0.00
R6049:Hace1 UTSW 10 45686662 missense probably damaging 1.00
R6111:Hace1 UTSW 10 45589510 missense possibly damaging 0.92
R6195:Hace1 UTSW 10 45670443 missense possibly damaging 0.70
R6216:Hace1 UTSW 10 45618547 missense probably benign
R6233:Hace1 UTSW 10 45670443 missense possibly damaging 0.70
R6237:Hace1 UTSW 10 45648890 missense probably benign
R6467:Hace1 UTSW 10 45590266 critical splice acceptor site probably null
R6930:Hace1 UTSW 10 45618502 missense probably damaging 1.00
R7325:Hace1 UTSW 10 45589507 nonsense probably null
R7401:Hace1 UTSW 10 45670626 missense probably damaging 1.00
R7426:Hace1 UTSW 10 45605540 missense probably damaging 1.00
R7471:Hace1 UTSW 10 45700979 missense probably benign 0.06
R7533:Hace1 UTSW 10 45711474 missense probably benign 0.03
R7661:Hace1 UTSW 10 45605553 missense probably damaging 1.00
R7873:Hace1 UTSW 10 45672787 missense possibly damaging 0.92
R7938:Hace1 UTSW 10 45686696 missense probably benign 0.11
R7995:Hace1 UTSW 10 45589492 missense probably damaging 1.00
R8017:Hace1 UTSW 10 45638382 missense probably damaging 1.00
R8019:Hace1 UTSW 10 45638382 missense probably damaging 1.00
R8022:Hace1 UTSW 10 45700970 missense probably damaging 1.00
R8292:Hace1 UTSW 10 45711461 nonsense probably null
R8717:Hace1 UTSW 10 45605598 missense unknown
R8757:Hace1 UTSW 10 45670443 missense possibly damaging 0.70
R8823:Hace1 UTSW 10 45648860 missense probably damaging 1.00
R8898:Hace1 UTSW 10 45700670 missense probably benign 0.01
R9143:Hace1 UTSW 10 45686668 missense probably damaging 0.99
R9297:Hace1 UTSW 10 45652673 missense probably benign 0.00
R9318:Hace1 UTSW 10 45652673 missense probably benign 0.00
R9365:Hace1 UTSW 10 45709996 critical splice donor site probably null
R9492:Hace1 UTSW 10 45671134 missense probably benign 0.10
R9644:Hace1 UTSW 10 45649905 missense probably benign 0.01
R9656:Hace1 UTSW 10 45671449 missense probably benign 0.00
R9762:Hace1 UTSW 10 45648918 missense probably benign 0.03
Z1176:Hace1 UTSW 10 45686662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAGACAGTTGGTTAGTGAAC -3'
(R):5'- AGCACGAATGGGATTGATTTATGTG -3'

Sequencing Primer
(F):5'- GGTTCCACCTAATGTGTTC -3'
(R):5'- TGTAAGAAAAACTTGAAAAGCTTACC -3'
Posted On 2021-04-30