Incidental Mutation 'R8814:Cep85l'
ID 672619
Institutional Source Beutler Lab
Gene Symbol Cep85l
Ensembl Gene ENSMUSG00000038594
Gene Name centrosomal protein 85-like
Synonyms Gm9766
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 53273443-53379947 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53348969 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 175 (Y175N)
Ref Sequence ENSEMBL: ENSMUSP00000151909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046221] [ENSMUST00000095691] [ENSMUST00000163319] [ENSMUST00000218468] [ENSMUST00000219491] [ENSMUST00000219921] [ENSMUST00000220197] [ENSMUST00000220376] [ENSMUST00000220443]
AlphaFold A0A1W2P884
Predicted Effect probably benign
Transcript: ENSMUST00000046221
SMART Domains Protein: ENSMUSP00000045709
Gene: ENSMUSG00000038583

DomainStartEndE-ValueType
Pfam:Phospholamban 1 52 2.7e-41 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000093356
Gene: ENSMUSG00000038594
AA Change: Y73N

DomainStartEndE-ValueType
coiled coil region 442 578 N/A INTRINSIC
coiled coil region 600 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163319
SMART Domains Protein: ENSMUSP00000132743
Gene: ENSMUSG00000038583

DomainStartEndE-ValueType
Pfam:Phospholamban 1 52 2.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218468
Predicted Effect probably benign
Transcript: ENSMUST00000219491
Predicted Effect probably benign
Transcript: ENSMUST00000219921
Predicted Effect probably benign
Transcript: ENSMUST00000220197
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000220443
AA Change: Y175N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a breast cancer antigen. Nothing more is known of its function at this time. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
Brd7 A G 8: 88,345,154 V361A probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cacna2d3 T A 14: 29,097,815 Y532F probably damaging Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Crispld2 A G 8: 120,015,345 H144R possibly damaging Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hace1 A G 10: 45,652,701 Y346C probably damaging Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Mterf1b T C 5: 4,197,456 S366P probably damaging Het
Nrxn1 A T 17: 90,630,101 C643S probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr485 T A 7: 108,159,065 K269N probably benign Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Scarb1 A T 5: 125,294,092 D305E probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slfn8 A G 11: 83,016,679 V346A possibly damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Soga1 C T 2: 157,030,531 W965* probably null Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Uaca A G 9: 60,866,398 N396D possibly damaging Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Vps8 T C 16: 21,576,650 L1230P probably damaging Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Cep85l
AlleleSourceChrCoordTypePredicted EffectPPH Score
debauchery UTSW 10 53348815 missense possibly damaging 0.77
saturnalia UTSW 10 53319594 splice site probably null
R0103:Cep85l UTSW 10 53278174 missense possibly damaging 0.53
R0103:Cep85l UTSW 10 53278174 missense possibly damaging 0.53
R0559:Cep85l UTSW 10 53348501 missense probably benign 0.00
R0689:Cep85l UTSW 10 53348847 missense probably damaging 1.00
R0750:Cep85l UTSW 10 53281546 missense probably damaging 0.99
R0969:Cep85l UTSW 10 53281496 missense probably benign 0.00
R1375:Cep85l UTSW 10 53349258 missense probably damaging 0.99
R1542:Cep85l UTSW 10 53301584 missense probably damaging 1.00
R1611:Cep85l UTSW 10 53348681 missense probably benign
R1749:Cep85l UTSW 10 53278154 missense probably damaging 1.00
R1826:Cep85l UTSW 10 53348812 missense possibly damaging 0.89
R2007:Cep85l UTSW 10 53278075 utr 3 prime probably benign
R2043:Cep85l UTSW 10 53358128 missense possibly damaging 0.64
R2144:Cep85l UTSW 10 53358126 missense probably benign 0.04
R2186:Cep85l UTSW 10 53348618 missense probably damaging 0.97
R2201:Cep85l UTSW 10 53348731 missense probably benign 0.01
R3767:Cep85l UTSW 10 53291810 missense probably benign 0.09
R5249:Cep85l UTSW 10 53319594 splice site probably null
R5764:Cep85l UTSW 10 53348994 missense probably benign 0.00
R6207:Cep85l UTSW 10 53281555 missense probably benign
R6333:Cep85l UTSW 10 53349101 nonsense probably null
R6422:Cep85l UTSW 10 53291780 missense possibly damaging 0.62
R6511:Cep85l UTSW 10 53278092 missense probably benign 0.00
R6645:Cep85l UTSW 10 53301672 missense probably benign 0.26
R6863:Cep85l UTSW 10 53349118 missense probably damaging 1.00
R6904:Cep85l UTSW 10 53349098 missense probably benign 0.00
R7000:Cep85l UTSW 10 53298199 missense probably damaging 1.00
R7015:Cep85l UTSW 10 53349055 missense possibly damaging 0.89
R7256:Cep85l UTSW 10 53296255 missense probably damaging 1.00
R7425:Cep85l UTSW 10 53301570 missense probably damaging 1.00
R7583:Cep85l UTSW 10 53281354 missense probably damaging 1.00
R7796:Cep85l UTSW 10 53281401 missense probably damaging 0.96
R7960:Cep85l UTSW 10 53296307 missense probably benign
R7969:Cep85l UTSW 10 53298184 missense probably damaging 1.00
R8042:Cep85l UTSW 10 53348663 missense probably damaging 1.00
R8103:Cep85l UTSW 10 53299324 splice site probably null
R8251:Cep85l UTSW 10 53281354 missense probably damaging 1.00
R8460:Cep85l UTSW 10 53349217 missense probably benign 0.18
R8698:Cep85l UTSW 10 53358105 missense probably damaging 0.98
R8888:Cep85l UTSW 10 53348815 missense possibly damaging 0.77
R8895:Cep85l UTSW 10 53348815 missense possibly damaging 0.77
R9090:Cep85l UTSW 10 53281574 nonsense probably null
R9271:Cep85l UTSW 10 53281574 nonsense probably null
R9293:Cep85l UTSW 10 53298186 missense probably damaging 1.00
R9478:Cep85l UTSW 10 53348779 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AAGTCTGTCTCCTGAGAGCAG -3'
(R):5'- AACACCAGATGGCTCTAAATGG -3'

Sequencing Primer
(F):5'- GGAAGAGACTCTGACATCTTCTTTG -3'
(R):5'- GGCTCTAAATGGAGTACTAGCCTC -3'
Posted On 2021-04-30