Incidental Mutation 'R8814:Cep85l'
ID 672619
Institutional Source Beutler Lab
Gene Symbol Cep85l
Ensembl Gene ENSMUSG00000038594
Gene Name centrosomal protein 85-like
Synonyms Gm9766
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.167) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 53149539-53256043 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53225065 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 175 (Y175N)
Ref Sequence ENSEMBL: ENSMUSP00000151909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046221] [ENSMUST00000095691] [ENSMUST00000163319] [ENSMUST00000218468] [ENSMUST00000219491] [ENSMUST00000219921] [ENSMUST00000220197] [ENSMUST00000220443] [ENSMUST00000220376]
AlphaFold A0A1W2P884
Predicted Effect probably benign
Transcript: ENSMUST00000046221
SMART Domains Protein: ENSMUSP00000045709
Gene: ENSMUSG00000038583

DomainStartEndE-ValueType
Pfam:Phospholamban 1 52 2.7e-41 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000093356
Gene: ENSMUSG00000038594
AA Change: Y73N

DomainStartEndE-ValueType
coiled coil region 442 578 N/A INTRINSIC
coiled coil region 600 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163319
SMART Domains Protein: ENSMUSP00000132743
Gene: ENSMUSG00000038583

DomainStartEndE-ValueType
Pfam:Phospholamban 1 52 2.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218468
Predicted Effect probably benign
Transcript: ENSMUST00000219491
Predicted Effect probably benign
Transcript: ENSMUST00000219921
Predicted Effect probably benign
Transcript: ENSMUST00000220197
Predicted Effect probably benign
Transcript: ENSMUST00000220443
AA Change: Y175N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a breast cancer antigen. Nothing more is known of its function at this time. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Cep85l
AlleleSourceChrCoordTypePredicted EffectPPH Score
debauchery UTSW 10 53,224,911 (GRCm39) missense possibly damaging 0.77
saturnalia UTSW 10 53,195,690 (GRCm39) splice site probably null
R0103:Cep85l UTSW 10 53,154,270 (GRCm39) missense possibly damaging 0.53
R0103:Cep85l UTSW 10 53,154,270 (GRCm39) missense possibly damaging 0.53
R0559:Cep85l UTSW 10 53,224,597 (GRCm39) missense probably benign 0.00
R0689:Cep85l UTSW 10 53,224,943 (GRCm39) missense probably damaging 1.00
R0750:Cep85l UTSW 10 53,157,642 (GRCm39) missense probably damaging 0.99
R0969:Cep85l UTSW 10 53,157,592 (GRCm39) missense probably benign 0.00
R1375:Cep85l UTSW 10 53,225,354 (GRCm39) missense probably damaging 0.99
R1542:Cep85l UTSW 10 53,177,680 (GRCm39) missense probably damaging 1.00
R1611:Cep85l UTSW 10 53,224,777 (GRCm39) missense probably benign
R1749:Cep85l UTSW 10 53,154,250 (GRCm39) missense probably damaging 1.00
R1826:Cep85l UTSW 10 53,224,908 (GRCm39) missense possibly damaging 0.89
R2007:Cep85l UTSW 10 53,154,171 (GRCm39) utr 3 prime probably benign
R2043:Cep85l UTSW 10 53,234,224 (GRCm39) missense possibly damaging 0.64
R2144:Cep85l UTSW 10 53,234,222 (GRCm39) missense probably benign 0.04
R2186:Cep85l UTSW 10 53,224,714 (GRCm39) missense probably damaging 0.97
R2201:Cep85l UTSW 10 53,224,827 (GRCm39) missense probably benign 0.01
R3767:Cep85l UTSW 10 53,167,906 (GRCm39) missense probably benign 0.09
R5249:Cep85l UTSW 10 53,195,690 (GRCm39) splice site probably null
R5764:Cep85l UTSW 10 53,225,090 (GRCm39) missense probably benign 0.00
R6207:Cep85l UTSW 10 53,157,651 (GRCm39) missense probably benign
R6333:Cep85l UTSW 10 53,225,197 (GRCm39) nonsense probably null
R6422:Cep85l UTSW 10 53,167,876 (GRCm39) missense possibly damaging 0.62
R6511:Cep85l UTSW 10 53,154,188 (GRCm39) missense probably benign 0.00
R6645:Cep85l UTSW 10 53,177,768 (GRCm39) missense probably benign 0.26
R6863:Cep85l UTSW 10 53,225,214 (GRCm39) missense probably damaging 1.00
R6904:Cep85l UTSW 10 53,225,194 (GRCm39) missense probably benign 0.00
R7000:Cep85l UTSW 10 53,174,295 (GRCm39) missense probably damaging 1.00
R7015:Cep85l UTSW 10 53,225,151 (GRCm39) missense possibly damaging 0.89
R7256:Cep85l UTSW 10 53,172,351 (GRCm39) missense probably damaging 1.00
R7425:Cep85l UTSW 10 53,177,666 (GRCm39) missense probably damaging 1.00
R7583:Cep85l UTSW 10 53,157,450 (GRCm39) missense probably damaging 1.00
R7796:Cep85l UTSW 10 53,157,497 (GRCm39) missense probably damaging 0.96
R7960:Cep85l UTSW 10 53,172,403 (GRCm39) missense probably benign
R7969:Cep85l UTSW 10 53,174,280 (GRCm39) missense probably damaging 1.00
R8042:Cep85l UTSW 10 53,224,759 (GRCm39) missense probably damaging 1.00
R8103:Cep85l UTSW 10 53,175,420 (GRCm39) splice site probably null
R8251:Cep85l UTSW 10 53,157,450 (GRCm39) missense probably damaging 1.00
R8460:Cep85l UTSW 10 53,225,313 (GRCm39) missense probably benign 0.18
R8698:Cep85l UTSW 10 53,234,201 (GRCm39) missense probably damaging 0.98
R8888:Cep85l UTSW 10 53,224,911 (GRCm39) missense possibly damaging 0.77
R8895:Cep85l UTSW 10 53,224,911 (GRCm39) missense possibly damaging 0.77
R9090:Cep85l UTSW 10 53,157,670 (GRCm39) nonsense probably null
R9271:Cep85l UTSW 10 53,157,670 (GRCm39) nonsense probably null
R9293:Cep85l UTSW 10 53,174,282 (GRCm39) missense probably damaging 1.00
R9478:Cep85l UTSW 10 53,224,875 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AAGTCTGTCTCCTGAGAGCAG -3'
(R):5'- AACACCAGATGGCTCTAAATGG -3'

Sequencing Primer
(F):5'- GGAAGAGACTCTGACATCTTCTTTG -3'
(R):5'- GGCTCTAAATGGAGTACTAGCCTC -3'
Posted On 2021-04-30