Mutagenetix > Incidental Mutation

Incidental Mutation 'R8814:Cep85l'

672619

Institutional Source

Beutler Lab

Gene Symbol

Cep85l

Ensembl Gene

ENSMUSG00000038594

Gene Name

centrosomal protein 85-like

Synonyms

Gm9766

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.229) question?

Stock #

R8814 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53273443-53379947 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53348969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 175 (Y175N)

Ref Sequence

ENSEMBL: ENSMUSP00000151909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046221] [ENSMUST00000095691] [ENSMUST00000163319] [ENSMUST00000218468] [ENSMUST00000219491] [ENSMUST00000219921] [ENSMUST00000220197] [ENSMUST00000220376] [ENSMUST00000220443]

AlphaFold

A0A1W2P884

Predicted Effect

probably benign
Transcript: ENSMUST00000046221

SMART Domains

Protein: ENSMUSP00000045709
Gene: ENSMUSG00000038583

Domain	Start	End	E-Value	Type
Pfam:Phospholamban	1	52	2.7e-41	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000093356
Gene: ENSMUSG00000038594
AA Change: Y73N

Domain	Start	End	E-Value	Type
coiled coil region	442	578	N/A	INTRINSIC
coiled coil region	600	645	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163319

SMART Domains

Protein: ENSMUSP00000132743
Gene: ENSMUSG00000038583

Domain	Start	End	E-Value	Type
Pfam:Phospholamban	1	52	2.7e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000218468

Predicted Effect

probably benign
Transcript: ENSMUST00000219491

Predicted Effect

probably benign
Transcript: ENSMUST00000219921

Predicted Effect

probably benign
Transcript: ENSMUST00000220197

Predicted Effect

probably benign
Transcript: ENSMUST00000220443
AA Change: Y175N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a breast cancer antigen. Nothing more is known of its function at this time. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	C	6: 129,325,604		probably benign	Het
Brd7	A	G	8: 88,345,154	V361A	probably benign	Het
C6	A	T	15: 4,792,784	Q595L	probably benign	Het
Cacna2d3	T	A	14: 29,097,815	Y532F	probably damaging	Het
Clca3a2	G	T	3: 144,797,764	N808K	probably benign	Het
Cpsf4	T	G	5: 145,178,868	S201R	probably benign	Het
Crispld2	A	G	8: 120,015,345	H144R	possibly damaging	Het
Cyp1b1	T	C	17: 79,713,359	E318G	probably benign	Het
Fam109a	G	T	5: 121,853,045	V157L	probably benign	Het
Fer1l4	A	G	2: 156,052,243	F47L	probably benign	Het
Flnb	A	G	14: 7,927,409	D1873G	probably damaging	Het
Gm47995	A	G	1: 151,198,988	M181V	probably benign	Het
Hace1	A	G	10: 45,652,701	Y346C	probably damaging	Het
Hemgn	G	T	4: 46,400,717	Q48K	possibly damaging	Het
Hhip	T	C	8: 80,051,472	D143G	probably damaging	Het
Ift74	C	T	4: 94,662,636	Q342*	probably null	Het
Kng2	A	T	16: 23,004,011	I197N	probably benign	Het
Lcat	G	A	8: 105,941,970	P167S	probably damaging	Het
Lmntd2	G	A	7: 141,210,084	R672W	probably damaging	Het
Mroh2b	G	T	15: 4,941,625	L1037F	possibly damaging	Het
Msh4	A	G	3: 153,872,320	S640P	probably damaging	Het
Mterf1b	T	C	5: 4,197,456	S366P	probably damaging	Het
Nrxn1	A	T	17: 90,630,101	C643S	probably damaging	Het
Olfr1164	T	A	2: 88,092,971	I322F	probably benign	Het
Olfr1496	T	A	19: 13,781,533	I305N	possibly damaging	Het
Olfr485	T	A	7: 108,159,065	K269N	probably benign	Het
Olfr605	A	G	7: 103,442,913	V70A	probably benign	Het
Olfr709-ps1	T	A	7: 106,926,818	I214F	probably damaging	Het
Pask	C	A	1: 93,320,585	R998L	probably benign	Het
Pcdh8	A	G	14: 79,768,897	L742P	probably benign	Het
Psma3	A	G	12: 70,978,806	E32G	probably benign	Het
Samd11	T	C	4: 156,247,884	E500G	probably benign	Het
Scarb1	A	T	5: 125,294,092	D305E	probably benign	Het
Serpinb6b	A	G	13: 32,978,304	H362R	possibly damaging	Het
Siglec1	G	A	2: 131,072,744	T1484M	probably damaging	Het
Slfn8	A	G	11: 83,016,679	V346A	possibly damaging	Het
Slitrk6	G	C	14: 110,749,938	A779G	probably benign	Het
Soga1	C	T	2: 157,030,531	W965*	probably null	Het
Sub1	A	C	15: 11,984,231	V124G	probably damaging	Het
Tbc1d32	A	G	10: 56,196,592	I277T	possibly damaging	Het
Tln2	C	A	9: 67,221,411	E1465D	possibly damaging	Het
Trappc10	A	G	10: 78,202,919	Y780H	probably damaging	Het
Trim28	T	A	7: 13,028,527	N359K	probably damaging	Het
Tspan15	G	A	10: 62,188,056	T281M	probably benign	Het
Uaca	A	G	9: 60,866,398	N396D	possibly damaging	Het
Vmn1r84	A	G	7: 12,362,458	S103P	probably damaging	Het
Vmn2r22	C	G	6: 123,637,830	R267T	probably damaging	Het
Vmn2r7	A	G	3: 64,716,563	I112T	probably benign	Het
Vmn2r70	T	A	7: 85,565,961	I122F	probably benign	Het
Vmn2r79	C	G	7: 87,002,506	T371S	probably benign	Het
Vps8	T	C	16: 21,576,650	L1230P	probably damaging	Het
Zfp26	A	T	9: 20,438,434	V278D	probably benign	Het

Other mutations in Cep85l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
debauchery	UTSW	10	53348815	missense	possibly damaging	0.77
saturnalia	UTSW	10	53319594	splice site	probably null
R0103:Cep85l	UTSW	10	53278174	missense	possibly damaging	0.53
R0103:Cep85l	UTSW	10	53278174	missense	possibly damaging	0.53
R0559:Cep85l	UTSW	10	53348501	missense	probably benign	0.00
R0689:Cep85l	UTSW	10	53348847	missense	probably damaging	1.00
R0750:Cep85l	UTSW	10	53281546	missense	probably damaging	0.99
R0969:Cep85l	UTSW	10	53281496	missense	probably benign	0.00
R1375:Cep85l	UTSW	10	53349258	missense	probably damaging	0.99
R1542:Cep85l	UTSW	10	53301584	missense	probably damaging	1.00
R1611:Cep85l	UTSW	10	53348681	missense	probably benign
R1749:Cep85l	UTSW	10	53278154	missense	probably damaging	1.00
R1826:Cep85l	UTSW	10	53348812	missense	possibly damaging	0.89
R2007:Cep85l	UTSW	10	53278075	utr 3 prime	probably benign
R2043:Cep85l	UTSW	10	53358128	missense	possibly damaging	0.64
R2144:Cep85l	UTSW	10	53358126	missense	probably benign	0.04
R2186:Cep85l	UTSW	10	53348618	missense	probably damaging	0.97
R2201:Cep85l	UTSW	10	53348731	missense	probably benign	0.01
R3767:Cep85l	UTSW	10	53291810	missense	probably benign	0.09
R5249:Cep85l	UTSW	10	53319594	splice site	probably null
R5764:Cep85l	UTSW	10	53348994	missense	probably benign	0.00
R6207:Cep85l	UTSW	10	53281555	missense	probably benign
R6333:Cep85l	UTSW	10	53349101	nonsense	probably null
R6422:Cep85l	UTSW	10	53291780	missense	possibly damaging	0.62
R6511:Cep85l	UTSW	10	53278092	missense	probably benign	0.00
R6645:Cep85l	UTSW	10	53301672	missense	probably benign	0.26
R6863:Cep85l	UTSW	10	53349118	missense	probably damaging	1.00
R6904:Cep85l	UTSW	10	53349098	missense	probably benign	0.00
R7000:Cep85l	UTSW	10	53298199	missense	probably damaging	1.00
R7015:Cep85l	UTSW	10	53349055	missense	possibly damaging	0.89
R7256:Cep85l	UTSW	10	53296255	missense	probably damaging	1.00
R7425:Cep85l	UTSW	10	53301570	missense	probably damaging	1.00
R7583:Cep85l	UTSW	10	53281354	missense	probably damaging	1.00
R7796:Cep85l	UTSW	10	53281401	missense	probably damaging	0.96
R7960:Cep85l	UTSW	10	53296307	missense	probably benign
R7969:Cep85l	UTSW	10	53298184	missense	probably damaging	1.00
R8042:Cep85l	UTSW	10	53348663	missense	probably damaging	1.00
R8103:Cep85l	UTSW	10	53299324	splice site	probably null
R8251:Cep85l	UTSW	10	53281354	missense	probably damaging	1.00
R8460:Cep85l	UTSW	10	53349217	missense	probably benign	0.18
R8698:Cep85l	UTSW	10	53358105	missense	probably damaging	0.98
R8888:Cep85l	UTSW	10	53348815	missense	possibly damaging	0.77
R8895:Cep85l	UTSW	10	53348815	missense	possibly damaging	0.77
R9090:Cep85l	UTSW	10	53281574	nonsense	probably null
R9271:Cep85l	UTSW	10	53281574	nonsense	probably null
R9293:Cep85l	UTSW	10	53298186	missense	probably damaging	1.00
R9478:Cep85l	UTSW	10	53348779	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- AAGTCTGTCTCCTGAGAGCAG -3'
(R):5'- AACACCAGATGGCTCTAAATGG -3'

Sequencing Primer
(F):5'- GGAAGAGACTCTGACATCTTCTTTG -3'
(R):5'- GGCTCTAAATGGAGTACTAGCCTC -3'

Posted On

2021-04-30