Mutagenetix > Incidental Mutation

Incidental Mutation 'R8814:Trappc10'

672622

Institutional Source

Beutler Lab

Gene Symbol

Trappc10

Ensembl Gene

ENSMUSG00000000374

Gene Name

trafficking protein particle complex 10

Synonyms

Tmem1, LOC380642, B230307C21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8814 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78186725-78244641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78202919 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 780 (Y780H)

Ref Sequence

ENSEMBL: ENSMUSP00000000384 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000384]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000000384
AA Change: Y780H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374
AA Change: Y780H

Domain	Start	End	E-Value	Type
Pfam:TRAPPC10	1016	1245	1.1e-45	PFAM

Predicted Effect

Meta Mutation Damage Score

0.1051

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular phenotypes, including atrioventricular or ventricular septal defects, thymus hypoplasia, and eye defects such as microphthalmia or anophthalmia. Holoprosencephaly, anencephaly and severe craniofacial defects may be also present. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	C	6: 129,325,604		probably benign	Het
Brd7	A	G	8: 88,345,154	V361A	probably benign	Het
C6	A	T	15: 4,792,784	Q595L	probably benign	Het
Cacna2d3	T	A	14: 29,097,815	Y532F	probably damaging	Het
Cep85l	A	T	10: 53,348,969	Y175N	probably benign	Het
Clca3a2	G	T	3: 144,797,764	N808K	probably benign	Het
Cpsf4	T	G	5: 145,178,868	S201R	probably benign	Het
Crispld2	A	G	8: 120,015,345	H144R	possibly damaging	Het
Cyp1b1	T	C	17: 79,713,359	E318G	probably benign	Het
Fam109a	G	T	5: 121,853,045	V157L	probably benign	Het
Fer1l4	A	G	2: 156,052,243	F47L	probably benign	Het
Flnb	A	G	14: 7,927,409	D1873G	probably damaging	Het
Gm47995	A	G	1: 151,198,988	M181V	probably benign	Het
Hace1	A	G	10: 45,652,701	Y346C	probably damaging	Het
Hemgn	G	T	4: 46,400,717	Q48K	possibly damaging	Het
Hhip	T	C	8: 80,051,472	D143G	probably damaging	Het
Ift74	C	T	4: 94,662,636	Q342*	probably null	Het
Kng2	A	T	16: 23,004,011	I197N	probably benign	Het
Lcat	G	A	8: 105,941,970	P167S	probably damaging	Het
Lmntd2	G	A	7: 141,210,084	R672W	probably damaging	Het
Mroh2b	G	T	15: 4,941,625	L1037F	possibly damaging	Het
Msh4	A	G	3: 153,872,320	S640P	probably damaging	Het
Mterf1b	T	C	5: 4,197,456	S366P	probably damaging	Het
Nrxn1	A	T	17: 90,630,101	C643S	probably damaging	Het
Olfr1164	T	A	2: 88,092,971	I322F	probably benign	Het
Olfr1496	T	A	19: 13,781,533	I305N	possibly damaging	Het
Olfr485	T	A	7: 108,159,065	K269N	probably benign	Het
Olfr605	A	G	7: 103,442,913	V70A	probably benign	Het
Olfr709-ps1	T	A	7: 106,926,818	I214F	probably damaging	Het
Pask	C	A	1: 93,320,585	R998L	probably benign	Het
Pcdh8	A	G	14: 79,768,897	L742P	probably benign	Het
Psma3	A	G	12: 70,978,806	E32G	probably benign	Het
Samd11	T	C	4: 156,247,884	E500G	probably benign	Het
Scarb1	A	T	5: 125,294,092	D305E	probably benign	Het
Serpinb6b	A	G	13: 32,978,304	H362R	possibly damaging	Het
Siglec1	G	A	2: 131,072,744	T1484M	probably damaging	Het
Slfn8	A	G	11: 83,016,679	V346A	possibly damaging	Het
Slitrk6	G	C	14: 110,749,938	A779G	probably benign	Het
Soga1	C	T	2: 157,030,531	W965*	probably null	Het
Sub1	A	C	15: 11,984,231	V124G	probably damaging	Het
Tbc1d32	A	G	10: 56,196,592	I277T	possibly damaging	Het
Tln2	C	A	9: 67,221,411	E1465D	possibly damaging	Het
Trim28	T	A	7: 13,028,527	N359K	probably damaging	Het
Tspan15	G	A	10: 62,188,056	T281M	probably benign	Het
Uaca	A	G	9: 60,866,398	N396D	possibly damaging	Het
Vmn1r84	A	G	7: 12,362,458	S103P	probably damaging	Het
Vmn2r22	C	G	6: 123,637,830	R267T	probably damaging	Het
Vmn2r7	A	G	3: 64,716,563	I112T	probably benign	Het
Vmn2r70	T	A	7: 85,565,961	I122F	probably benign	Het
Vmn2r79	C	G	7: 87,002,506	T371S	probably benign	Het
Vps8	T	C	16: 21,576,650	L1230P	probably damaging	Het
Zfp26	A	T	9: 20,438,434	V278D	probably benign	Het

Other mutations in Trappc10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Trappc10	APN	10	78203877	splice site	probably benign
IGL01375:Trappc10	APN	10	78188899	missense	possibly damaging	0.75
IGL01413:Trappc10	APN	10	78197844	missense	possibly damaging	0.87
IGL02413:Trappc10	APN	10	78210776	missense	probably damaging	0.99
IGL03037:Trappc10	APN	10	78199035	unclassified	probably benign
IGL03094:Trappc10	APN	10	78228920	splice site	probably benign
IGL03164:Trappc10	APN	10	78220242	missense	probably damaging	1.00
IGL03351:Trappc10	APN	10	78188761	missense	probably damaging	1.00
IGL03055:Trappc10	UTSW	10	78214686	missense	probably damaging	1.00
IGL03098:Trappc10	UTSW	10	78214686	missense	probably damaging	1.00
R0304:Trappc10	UTSW	10	78210760	splice site	probably benign
R0605:Trappc10	UTSW	10	78201497	missense	possibly damaging	0.70
R1806:Trappc10	UTSW	10	78210776	missense	probably damaging	0.99
R1856:Trappc10	UTSW	10	78196451	missense	probably benign	0.00
R2045:Trappc10	UTSW	10	78209479	splice site	probably benign
R2088:Trappc10	UTSW	10	78196334	missense	probably benign	0.00
R2126:Trappc10	UTSW	10	78203924	missense	possibly damaging	0.94
R2202:Trappc10	UTSW	10	78199042	critical splice donor site	probably null
R2509:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2510:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2511:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2893:Trappc10	UTSW	10	78193401	missense	probably benign	0.00
R3744:Trappc10	UTSW	10	78199090	missense	probably benign	0.00
R3778:Trappc10	UTSW	10	78200802	missense	possibly damaging	0.89
R3876:Trappc10	UTSW	10	78220186	splice site	probably null
R3930:Trappc10	UTSW	10	78210403	missense	probably benign	0.03
R4078:Trappc10	UTSW	10	78210382	missense	probably damaging	1.00
R4111:Trappc10	UTSW	10	78196430	missense	probably benign	0.09
R4418:Trappc10	UTSW	10	78217188	missense	probably damaging	1.00
R4549:Trappc10	UTSW	10	78231458	missense	probably damaging	1.00
R4695:Trappc10	UTSW	10	78197863	missense	probably damaging	0.99
R4799:Trappc10	UTSW	10	78201590	missense	possibly damaging	0.71
R5022:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5023:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5026:Trappc10	UTSW	10	78204288	missense	possibly damaging	0.82
R5057:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5282:Trappc10	UTSW	10	78187860	missense	probably damaging	1.00
R5363:Trappc10	UTSW	10	78188840	missense	possibly damaging	0.92
R5813:Trappc10	UTSW	10	78222739	missense	probably damaging	1.00
R5831:Trappc10	UTSW	10	78209426	missense	probably damaging	1.00
R6209:Trappc10	UTSW	10	78214812	missense	possibly damaging	0.50
R6450:Trappc10	UTSW	10	78209450	missense	possibly damaging	0.92
R6520:Trappc10	UTSW	10	78201453	missense	probably benign	0.00
R6533:Trappc10	UTSW	10	78188894	missense	probably damaging	0.96
R6767:Trappc10	UTSW	10	78193511	missense	possibly damaging	0.75
R6798:Trappc10	UTSW	10	78188831	missense	probably benign	0.00
R7205:Trappc10	UTSW	10	78210428	missense	probably damaging	1.00
R7282:Trappc10	UTSW	10	78207493	missense	probably damaging	0.98
R7378:Trappc10	UTSW	10	78193418	missense	probably damaging	0.96
R7384:Trappc10	UTSW	10	78209384	missense	possibly damaging	0.85
R7770:Trappc10	UTSW	10	78210845	missense	probably damaging	0.96
R7829:Trappc10	UTSW	10	78199075	missense	probably benign
R7839:Trappc10	UTSW	10	78188812	missense	possibly damaging	0.84
R8298:Trappc10	UTSW	10	78202919	missense	probably damaging	1.00
R8306:Trappc10	UTSW	10	78200626	missense	possibly damaging	0.54
R9035:Trappc10	UTSW	10	78207889	unclassified	probably benign
R9075:Trappc10	UTSW	10	78204296	missense	possibly damaging	0.77
R9112:Trappc10	UTSW	10	78193367	missense	probably damaging	0.99
R9182:Trappc10	UTSW	10	78214630	missense	probably damaging	1.00
R9444:Trappc10	UTSW	10	78197778	missense	probably benign	0.10
R9801:Trappc10	UTSW	10	78209429	missense	probably benign	0.00
Z1177:Trappc10	UTSW	10	78217153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGCTAGCAATCACAGGAC -3'
(R):5'- AGGACAGCCTGCCTTTATCTTC -3'

Sequencing Primer
(F):5'- ACAGATCTGCAGCCAGTGG -3'
(R):5'- CAGCACTTGTAACATATGAAGTGTC -3'

Posted On

2021-04-30