Incidental Mutation 'R8814:Slfn8'
ID 672623
Institutional Source Beutler Lab
Gene Symbol Slfn8
Ensembl Gene ENSMUSG00000035208
Gene Name schlafen 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 83002158-83020810 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83016679 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 346 (V346A)
Ref Sequence ENSEMBL: ENSMUSP00000040060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]
AlphaFold B1ARD8
Predicted Effect possibly damaging
Transcript: ENSMUST00000038141
AA Change: V346A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: V346A

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 1.6e-18 PFAM
Pfam:DUF2075 592 766 5.8e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092838
AA Change: V346A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: V346A

DomainStartEndE-ValueType
Pfam:AlbA_2 205 341 1.4e-17 PFAM
Pfam:DUF2075 592 767 2.2e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108152
AA Change: V346A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208
AA Change: V346A

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 4.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130822
AA Change: V346A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: V346A

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 3.7e-19 PFAM
SCOP:d1ly1a_ 593 625 4e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208
AA Change: V167A

DomainStartEndE-ValueType
Pfam:AlbA_2 27 163 1.8e-15 PFAM
SCOP:d1ly1a_ 370 402 2e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000215239
AA Change: V346A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
Brd7 A G 8: 88,345,154 V361A probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cacna2d3 T A 14: 29,097,815 Y532F probably damaging Het
Cep85l A T 10: 53,348,969 Y175N probably benign Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Crispld2 A G 8: 120,015,345 H144R possibly damaging Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hace1 A G 10: 45,652,701 Y346C probably damaging Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Mterf1b T C 5: 4,197,456 S366P probably damaging Het
Nrxn1 A T 17: 90,630,101 C643S probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr485 T A 7: 108,159,065 K269N probably benign Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Scarb1 A T 5: 125,294,092 D305E probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Soga1 C T 2: 157,030,531 W965* probably null Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Uaca A G 9: 60,866,398 N396D possibly damaging Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Vps8 T C 16: 21,576,650 L1230P probably damaging Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Slfn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Slfn8 APN 11 83013484 missense possibly damaging 0.75
IGL01418:Slfn8 APN 11 83004636 missense probably damaging 1.00
IGL01620:Slfn8 APN 11 83004233 nonsense probably null
IGL01875:Slfn8 APN 11 83004079 missense probably benign 0.30
IGL01896:Slfn8 APN 11 83003696 missense probably damaging 1.00
IGL01929:Slfn8 APN 11 83003405 nonsense probably null
IGL02111:Slfn8 APN 11 83004498 missense probably damaging 1.00
IGL02136:Slfn8 APN 11 83003465 nonsense probably null
IGL02165:Slfn8 APN 11 83017196 missense probably benign 0.00
IGL02645:Slfn8 APN 11 83003554 missense possibly damaging 0.82
IGL02682:Slfn8 APN 11 83003691 missense probably damaging 1.00
IGL02689:Slfn8 APN 11 83017108 missense probably damaging 1.00
IGL02948:Slfn8 APN 11 83003252 missense probably damaging 0.99
IGL03037:Slfn8 APN 11 83003252 missense probably damaging 0.99
IGL03185:Slfn8 APN 11 83017507 missense probably benign 0.01
IGL03243:Slfn8 APN 11 83003707 missense probably damaging 1.00
IGL03286:Slfn8 APN 11 83013468 missense probably damaging 0.99
seven_dwarfs UTSW 11 83003334 missense probably benign 0.09
vanwinkle UTSW 11 83017393 missense probably damaging 1.00
R0295:Slfn8 UTSW 11 83003343 nonsense probably null
R0368:Slfn8 UTSW 11 83017132 missense probably damaging 1.00
R0382:Slfn8 UTSW 11 83004556 missense probably damaging 1.00
R0655:Slfn8 UTSW 11 83003821 missense probably benign 0.35
R0894:Slfn8 UTSW 11 83003581 missense probably benign 0.07
R1006:Slfn8 UTSW 11 83003511 missense possibly damaging 0.69
R1181:Slfn8 UTSW 11 83016745 missense probably benign 0.19
R1187:Slfn8 UTSW 11 83003488 missense probably damaging 1.00
R1501:Slfn8 UTSW 11 83003180 missense probably damaging 0.99
R1646:Slfn8 UTSW 11 83016886 missense probably damaging 1.00
R1909:Slfn8 UTSW 11 83003621 nonsense probably null
R2005:Slfn8 UTSW 11 83004150 missense probably damaging 1.00
R2363:Slfn8 UTSW 11 83004094 missense probably damaging 1.00
R3780:Slfn8 UTSW 11 83017454 missense probably benign 0.13
R3890:Slfn8 UTSW 11 83004444 missense possibly damaging 0.68
R3917:Slfn8 UTSW 11 83016993 nonsense probably null
R4559:Slfn8 UTSW 11 83004744 missense probably damaging 1.00
R4684:Slfn8 UTSW 11 83017506 missense probably benign 0.10
R4767:Slfn8 UTSW 11 83003197 missense possibly damaging 0.66
R4773:Slfn8 UTSW 11 83017393 missense probably damaging 1.00
R4859:Slfn8 UTSW 11 83017714 start codon destroyed probably null 0.99
R4916:Slfn8 UTSW 11 83016878 missense probably damaging 1.00
R4939:Slfn8 UTSW 11 83003285 missense probably benign 0.01
R5107:Slfn8 UTSW 11 83017150 missense probably damaging 0.99
R5130:Slfn8 UTSW 11 83003821 missense probably benign 0.35
R5165:Slfn8 UTSW 11 83017127 missense probably damaging 0.99
R5238:Slfn8 UTSW 11 83013388 missense probably damaging 0.96
R5282:Slfn8 UTSW 11 83017724 critical splice acceptor site probably null
R5311:Slfn8 UTSW 11 83004084 missense probably damaging 1.00
R5499:Slfn8 UTSW 11 83004216 missense probably damaging 0.99
R5617:Slfn8 UTSW 11 83004721 missense probably benign 0.01
R5782:Slfn8 UTSW 11 83017041 missense probably damaging 0.98
R5823:Slfn8 UTSW 11 83016736 missense probably benign 0.01
R5886:Slfn8 UTSW 11 83003334 missense probably benign 0.09
R5933:Slfn8 UTSW 11 83003335 missense probably benign 0.00
R6151:Slfn8 UTSW 11 83017321 missense probably damaging 1.00
R6163:Slfn8 UTSW 11 83003864 makesense probably null
R6191:Slfn8 UTSW 11 83016800 missense possibly damaging 0.72
R6419:Slfn8 UTSW 11 83004055 splice site probably null
R6925:Slfn8 UTSW 11 83013417 nonsense probably null
R7065:Slfn8 UTSW 11 83016968 missense probably benign 0.01
R7380:Slfn8 UTSW 11 83003740 missense not run
R7414:Slfn8 UTSW 11 83016792 nonsense probably null
R7819:Slfn8 UTSW 11 83004255 missense probably damaging 1.00
R8425:Slfn8 UTSW 11 83004615 missense possibly damaging 0.80
R8517:Slfn8 UTSW 11 83004142 missense possibly damaging 0.68
R8804:Slfn8 UTSW 11 83016813 missense possibly damaging 0.94
R9069:Slfn8 UTSW 11 83017076 missense probably damaging 1.00
R9233:Slfn8 UTSW 11 83003596 missense probably damaging 1.00
R9457:Slfn8 UTSW 11 83017706 missense probably benign
R9678:Slfn8 UTSW 11 83016897 missense probably damaging 1.00
R9708:Slfn8 UTSW 11 83003441 missense probably benign 0.00
R9764:Slfn8 UTSW 11 83017012 missense probably damaging 1.00
X0021:Slfn8 UTSW 11 83016928 missense possibly damaging 0.69
Z1177:Slfn8 UTSW 11 83003533 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GTGGCATTTCCTTGGCCATC -3'
(R):5'- ACAATATCCAAGGTGCCAGTTTTC -3'

Sequencing Primer
(F):5'- TAATCCTAGTACTTGGGAGCAGTGAC -3'
(R):5'- TTGTTCATCTAAAGACAAGGACAAGG -3'
Posted On 2021-04-30