Incidental Mutation 'R8814:Cacna2d3'
ID 672627
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Name calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms alpha 2 delta-3, alpha2delta3
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 28626900-29443821 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28819772 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 532 (Y532F)
Ref Sequence ENSEMBL: ENSMUSP00000022567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000225733] [ENSMUST00000225863]
AlphaFold Q9Z1L5
Predicted Effect probably damaging
Transcript: ENSMUST00000022567
AA Change: Y532F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991
AA Change: Y532F

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225733
AA Change: Y266F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225863
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29,022,688 (GRCm39) splice site probably benign
IGL01150:Cacna2d3 APN 14 28,905,598 (GRCm39) missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28,665,548 (GRCm39) missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28,665,564 (GRCm39) missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 28,785,832 (GRCm39) unclassified probably benign
IGL02237:Cacna2d3 APN 14 29,068,954 (GRCm39) missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28,678,827 (GRCm39) splice site probably null
IGL02604:Cacna2d3 APN 14 29,015,066 (GRCm39) missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29,073,907 (GRCm39) splice site probably null
IGL02838:Cacna2d3 APN 14 29,022,785 (GRCm39) critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 28,786,276 (GRCm39) critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 28,780,388 (GRCm39) missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29,189,909 (GRCm39) missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28,674,243 (GRCm39) missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29,022,705 (GRCm39) missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29,442,834 (GRCm39) nonsense probably null
R0094:Cacna2d3 UTSW 14 28,892,460 (GRCm39) critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 28,767,601 (GRCm39) missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29,256,476 (GRCm39) missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29,189,906 (GRCm39) missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28,704,322 (GRCm39) missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 28,780,585 (GRCm39) missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 28,767,580 (GRCm39) missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 28,786,278 (GRCm39) splice site probably benign
R1312:Cacna2d3 UTSW 14 28,767,625 (GRCm39) missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28,703,137 (GRCm39) missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28,694,199 (GRCm39) missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28,691,171 (GRCm39) missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28,627,259 (GRCm39) missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 28,785,875 (GRCm39) missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29,068,880 (GRCm39) missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 28,905,538 (GRCm39) missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 28,825,670 (GRCm39) missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28,704,303 (GRCm39) missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29,015,092 (GRCm39) missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28,678,743 (GRCm39) splice site probably null
R4965:Cacna2d3 UTSW 14 28,704,289 (GRCm39) missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29,015,135 (GRCm39) missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29,068,987 (GRCm39) missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28,665,512 (GRCm39) critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29,442,891 (GRCm39) missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29,118,446 (GRCm39) missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28,630,278 (GRCm39) missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29,118,522 (GRCm39) missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 28,786,143 (GRCm39) unclassified probably benign
R6632:Cacna2d3 UTSW 14 28,627,222 (GRCm39) makesense probably null
R6706:Cacna2d3 UTSW 14 28,846,642 (GRCm39) critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 28,777,934 (GRCm39) missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28,691,275 (GRCm39) intron probably benign
R7009:Cacna2d3 UTSW 14 28,691,322 (GRCm39) start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28,691,260 (GRCm39) intron probably benign
R7146:Cacna2d3 UTSW 14 29,443,654 (GRCm39) missense unknown
R7427:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 28,780,575 (GRCm39) missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 28,767,501 (GRCm39) splice site probably null
R7560:Cacna2d3 UTSW 14 28,780,378 (GRCm39) missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 28,765,503 (GRCm39) missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 28,826,995 (GRCm39) splice site probably benign
R8096:Cacna2d3 UTSW 14 28,825,657 (GRCm39) missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28,704,328 (GRCm39) missense probably benign 0.25
R8838:Cacna2d3 UTSW 14 28,691,220 (GRCm39) missense probably benign 0.03
R8864:Cacna2d3 UTSW 14 29,055,735 (GRCm39) missense probably damaging 1.00
R9103:Cacna2d3 UTSW 14 29,068,971 (GRCm39) missense probably damaging 1.00
R9341:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9343:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9567:Cacna2d3 UTSW 14 28,627,268 (GRCm39) missense probably benign 0.38
Z1088:Cacna2d3 UTSW 14 28,786,265 (GRCm39) missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29,069,120 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GATGCACCTGTGAGTCAAAATAC -3'
(R):5'- TGTCAAGGATCAGTGCCTCG -3'

Sequencing Primer
(F):5'- CTAGTTTGAAGCTATGCAAACAGCC -3'
(R):5'- AGGATCAGTGCCTCGAATTC -3'
Posted On 2021-04-30