Incidental Mutation 'R8814:Cacna2d3'
ID 672627
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Name calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms alpha2delta3, alpha 2 delta-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 28904943-29721864 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29097815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 532 (Y532F)
Ref Sequence ENSEMBL: ENSMUSP00000022567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000225733] [ENSMUST00000225863]
AlphaFold Q9Z1L5
Predicted Effect probably damaging
Transcript: ENSMUST00000022567
AA Change: Y532F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991
AA Change: Y532F

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225733
AA Change: Y266F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225863
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
Brd7 A G 8: 88,345,154 V361A probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cep85l A T 10: 53,348,969 Y175N probably benign Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Crispld2 A G 8: 120,015,345 H144R possibly damaging Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hace1 A G 10: 45,652,701 Y346C probably damaging Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Mterf1b T C 5: 4,197,456 S366P probably damaging Het
Nrxn1 A T 17: 90,630,101 C643S probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr485 T A 7: 108,159,065 K269N probably benign Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Scarb1 A T 5: 125,294,092 D305E probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slfn8 A G 11: 83,016,679 V346A possibly damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Soga1 C T 2: 157,030,531 W965* probably null Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Uaca A G 9: 60,866,398 N396D possibly damaging Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Vps8 T C 16: 21,576,650 L1230P probably damaging Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29300731 splice site probably benign
IGL01150:Cacna2d3 APN 14 29183641 missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28943591 missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28943607 missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 29063875 unclassified probably benign
IGL02237:Cacna2d3 APN 14 29346997 missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28956870 splice site probably null
IGL02604:Cacna2d3 APN 14 29293109 missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29351950 splice site probably null
IGL02838:Cacna2d3 APN 14 29300828 critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 29064319 critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 29058431 missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29467952 missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28952286 missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29300748 missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29720877 nonsense probably null
R0094:Cacna2d3 UTSW 14 29170503 critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 29045644 missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29534519 missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29467949 missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28982365 missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 29058628 missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 29045623 missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 29064321 splice site probably benign
R1312:Cacna2d3 UTSW 14 29045668 missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28981180 missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28972242 missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28969214 missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28905302 missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 29063918 missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29346923 missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 29183581 missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 29103713 missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28982346 missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29293135 missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28956786 splice site probably null
R4965:Cacna2d3 UTSW 14 28982332 missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29293178 missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29347030 missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28943555 critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29720934 missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29396489 missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28908321 missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29396565 missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 29064186 unclassified probably benign
R6632:Cacna2d3 UTSW 14 28905265 makesense probably null
R6706:Cacna2d3 UTSW 14 29124685 critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 29055977 missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28969318 intron probably benign
R7009:Cacna2d3 UTSW 14 28969365 start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28969303 intron probably benign
R7146:Cacna2d3 UTSW 14 29721697 missense unknown
R7427:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 29058618 missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 29045544 splice site probably null
R7560:Cacna2d3 UTSW 14 29058421 missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 29043546 missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 29105038 splice site probably benign
R8096:Cacna2d3 UTSW 14 29103700 missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28982371 missense probably benign 0.25
R8838:Cacna2d3 UTSW 14 28969263 missense probably benign 0.03
R8864:Cacna2d3 UTSW 14 29333778 missense probably damaging 1.00
R9103:Cacna2d3 UTSW 14 29347014 missense probably damaging 1.00
R9341:Cacna2d3 UTSW 14 28982358 missense possibly damaging 0.92
R9343:Cacna2d3 UTSW 14 28982358 missense possibly damaging 0.92
R9567:Cacna2d3 UTSW 14 28905311 missense probably benign 0.38
Z1088:Cacna2d3 UTSW 14 29064308 missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29347163 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GATGCACCTGTGAGTCAAAATAC -3'
(R):5'- TGTCAAGGATCAGTGCCTCG -3'

Sequencing Primer
(F):5'- CTAGTTTGAAGCTATGCAAACAGCC -3'
(R):5'- AGGATCAGTGCCTCGAATTC -3'
Posted On 2021-04-30