Incidental Mutation 'R8814:Pcdh8'
ID 672628
Institutional Source Beutler Lab
Gene Symbol Pcdh8
Ensembl Gene ENSMUSG00000036422
Gene Name protocadherin 8
Synonyms Papc, 1700080P15Rik
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 80004224-80008752 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80006337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 742 (L742P)
Ref Sequence ENSEMBL: ENSMUSP00000045333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039568] [ENSMUST00000195355]
AlphaFold Q7TSK3
Predicted Effect probably benign
Transcript: ENSMUST00000039568
AA Change: L742P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045333
Gene: ENSMUSG00000036422
AA Change: L742P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 45 133 8.69e-2 SMART
CA 157 243 1.22e-14 SMART
CA 268 352 6.08e-24 SMART
low complexity region 360 392 N/A INTRINSIC
CA 414 495 5.34e-20 SMART
CA 519 607 1.57e-26 SMART
CA 636 718 1.12e-4 SMART
transmembrane domain 748 770 N/A INTRINSIC
low complexity region 782 802 N/A INTRINSIC
low complexity region 828 860 N/A INTRINSIC
low complexity region 910 933 N/A INTRINSIC
low complexity region 974 980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195355
AA Change: L742P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141417
Gene: ENSMUSG00000036422
AA Change: L742P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 45 133 8.69e-2 SMART
CA 157 243 1.22e-14 SMART
CA 268 352 6.08e-24 SMART
low complexity region 360 392 N/A INTRINSIC
CA 414 495 5.34e-20 SMART
CA 519 607 1.57e-26 SMART
CA 636 718 1.12e-4 SMART
transmembrane domain 748 770 N/A INTRINSIC
low complexity region 813 836 N/A INTRINSIC
low complexity region 877 883 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a type I transmembrane protein composed of an extracellular domain including 6 cadherin ectodomains, a single-pass transmembrane domain and a cytoplasmic tail. Unlike classical cadherins, which are generally encoded by 15-17 exons, this gene includes only 3 exons with the first large exon encoding the extracellular and transmembrane region. Although this gene product is capable of homophilic interaction, it appears to affect cell-cell adhesion indirectly by initiating signaling events that regulate classical cadherin-mediated adhesion. Based on studies on this protein and its orthologs, this protocadherin mainly functions in developing embryos and the central nervous system, but can also function as a tumor suppressor. Alternative splicing yielding isoforms with unique cytoplasmic tails has been reported. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice are viable and fertile, and do not exhibit any gross skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Pcdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pcdh8 APN 14 80,006,686 (GRCm39) missense probably damaging 0.99
IGL02611:Pcdh8 APN 14 80,005,107 (GRCm39) missense probably benign 0.00
R0094:Pcdh8 UTSW 14 80,005,588 (GRCm39) missense probably damaging 1.00
R0118:Pcdh8 UTSW 14 80,004,848 (GRCm39) missense probably damaging 1.00
R0558:Pcdh8 UTSW 14 80,007,516 (GRCm39) missense probably damaging 1.00
R0681:Pcdh8 UTSW 14 80,007,400 (GRCm39) missense probably benign
R0718:Pcdh8 UTSW 14 80,008,131 (GRCm39) missense possibly damaging 0.49
R1281:Pcdh8 UTSW 14 80,005,166 (GRCm39) missense probably damaging 1.00
R1487:Pcdh8 UTSW 14 80,006,987 (GRCm39) missense probably damaging 1.00
R1511:Pcdh8 UTSW 14 80,006,829 (GRCm39) missense possibly damaging 0.46
R1552:Pcdh8 UTSW 14 80,008,047 (GRCm39) missense probably benign 0.20
R1556:Pcdh8 UTSW 14 80,007,843 (GRCm39) missense probably damaging 1.00
R1659:Pcdh8 UTSW 14 80,005,574 (GRCm39) missense probably damaging 1.00
R2062:Pcdh8 UTSW 14 80,005,651 (GRCm39) missense probably damaging 1.00
R2063:Pcdh8 UTSW 14 80,005,651 (GRCm39) missense probably damaging 1.00
R2068:Pcdh8 UTSW 14 80,005,651 (GRCm39) missense probably damaging 1.00
R2920:Pcdh8 UTSW 14 80,006,154 (GRCm39) missense possibly damaging 0.88
R3970:Pcdh8 UTSW 14 80,007,706 (GRCm39) missense possibly damaging 0.78
R4113:Pcdh8 UTSW 14 80,004,953 (GRCm39) missense probably damaging 1.00
R4771:Pcdh8 UTSW 14 80,005,710 (GRCm39) missense possibly damaging 0.48
R4840:Pcdh8 UTSW 14 80,008,308 (GRCm39) missense possibly damaging 0.67
R5169:Pcdh8 UTSW 14 80,005,095 (GRCm39) missense probably benign 0.09
R5187:Pcdh8 UTSW 14 80,007,594 (GRCm39) missense probably damaging 0.99
R5415:Pcdh8 UTSW 14 80,007,688 (GRCm39) nonsense probably null
R5548:Pcdh8 UTSW 14 80,004,942 (GRCm39) missense probably damaging 1.00
R5749:Pcdh8 UTSW 14 80,007,525 (GRCm39) missense probably damaging 1.00
R5778:Pcdh8 UTSW 14 80,008,197 (GRCm39) missense probably damaging 1.00
R5795:Pcdh8 UTSW 14 80,008,420 (GRCm39) missense possibly damaging 0.95
R6313:Pcdh8 UTSW 14 80,005,091 (GRCm39) missense probably benign 0.02
R7472:Pcdh8 UTSW 14 80,008,691 (GRCm39) splice site probably null
R7540:Pcdh8 UTSW 14 80,008,543 (GRCm39) missense probably benign
R7653:Pcdh8 UTSW 14 80,005,086 (GRCm39) missense probably benign 0.01
R7751:Pcdh8 UTSW 14 80,008,143 (GRCm39) missense probably damaging 0.96
R7836:Pcdh8 UTSW 14 80,006,101 (GRCm39) missense possibly damaging 0.73
R8281:Pcdh8 UTSW 14 80,006,919 (GRCm39) missense probably damaging 0.98
R8365:Pcdh8 UTSW 14 80,008,426 (GRCm39) missense probably damaging 1.00
R8751:Pcdh8 UTSW 14 80,006,229 (GRCm39) missense probably benign 0.01
R8931:Pcdh8 UTSW 14 80,006,971 (GRCm39) nonsense probably null
R9158:Pcdh8 UTSW 14 80,005,182 (GRCm39) missense probably damaging 1.00
R9485:Pcdh8 UTSW 14 80,005,689 (GRCm39) missense probably damaging 1.00
R9532:Pcdh8 UTSW 14 80,008,206 (GRCm39) missense possibly damaging 0.95
R9558:Pcdh8 UTSW 14 80,006,380 (GRCm39) missense probably damaging 0.99
Z1176:Pcdh8 UTSW 14 80,006,517 (GRCm39) missense probably benign 0.01
Z1177:Pcdh8 UTSW 14 80,007,321 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GAGCACGTCGAACATGTTG -3'
(R):5'- TGCTTACTGGAGACCTCTCG -3'

Sequencing Primer
(F):5'- CGTCGAACATGTTGGGCCTG -3'
(R):5'- CCTGGCCGCGTGTTCAAG -3'
Posted On 2021-04-30