Incidental Mutation 'R8814:C6'
ID 672630
Institutional Source Beutler Lab
Gene Symbol C6
Ensembl Gene ENSMUSG00000022181
Gene Name complement component 6
Synonyms
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 4756550-4833527 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4822266 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 595 (Q595L)
Ref Sequence ENSEMBL: ENSMUSP00000124417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022788] [ENSMUST00000162350] [ENSMUST00000162585]
AlphaFold E9Q6D8
Predicted Effect probably benign
Transcript: ENSMUST00000022788
AA Change: Q595L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022788
Gene: ENSMUSG00000022181
AA Change: Q595L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000125693
Gene: ENSMUSG00000022181
AA Change: Q595L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Blast:FIMAC 859 931 1e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162585
AA Change: Q595L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124417
Gene: ENSMUSG00000022181
AA Change: Q595L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the complement cascade. The encoded protein is part of the membrane attack complex that can be incorporated into the cell membrane and cause cell lysis. Mutations in this gene are associated with complement component-6 deficiency. Transcript variants encoding the same protein have been described.[provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit decreased susceptibility to ischemia reperfusion-induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in C6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:C6 APN 15 4,789,449 (GRCm39) missense possibly damaging 0.53
IGL00918:C6 APN 15 4,764,739 (GRCm39) missense possibly damaging 0.90
IGL01615:C6 APN 15 4,811,378 (GRCm39) missense probably benign 0.00
IGL01637:C6 APN 15 4,789,399 (GRCm39) missense possibly damaging 0.69
IGL01662:C6 APN 15 4,822,236 (GRCm39) missense probably damaging 1.00
IGL02293:C6 APN 15 4,784,785 (GRCm39) missense probably benign 0.01
IGL02431:C6 APN 15 4,789,343 (GRCm39) nonsense probably null
IGL02568:C6 APN 15 4,820,646 (GRCm39) nonsense probably null
IGL02688:C6 APN 15 4,827,802 (GRCm39) missense probably benign 0.00
IGL02737:C6 APN 15 4,826,396 (GRCm39) missense probably benign 0.30
R0195:C6 UTSW 15 4,792,953 (GRCm39) missense probably benign 0.01
R0334:C6 UTSW 15 4,784,849 (GRCm39) missense probably benign 0.24
R0879:C6 UTSW 15 4,792,818 (GRCm39) splice site probably benign
R0940:C6 UTSW 15 4,764,717 (GRCm39) missense probably benign 0.12
R1342:C6 UTSW 15 4,769,231 (GRCm39) splice site probably benign
R1649:C6 UTSW 15 4,764,739 (GRCm39) missense possibly damaging 0.90
R1709:C6 UTSW 15 4,820,452 (GRCm39) missense probably benign 0.34
R1967:C6 UTSW 15 4,789,302 (GRCm39) missense probably damaging 0.99
R2068:C6 UTSW 15 4,820,552 (GRCm39) missense probably damaging 1.00
R3056:C6 UTSW 15 4,769,355 (GRCm39) missense probably damaging 0.99
R3791:C6 UTSW 15 4,764,717 (GRCm39) missense probably benign 0.00
R3821:C6 UTSW 15 4,819,066 (GRCm39) missense probably benign 0.23
R3895:C6 UTSW 15 4,837,952 (GRCm39) missense probably benign 0.00
R4178:C6 UTSW 15 4,764,621 (GRCm39) missense probably benign 0.02
R4440:C6 UTSW 15 4,764,733 (GRCm39) missense possibly damaging 0.90
R4598:C6 UTSW 15 4,792,852 (GRCm39) missense possibly damaging 0.55
R4632:C6 UTSW 15 4,789,350 (GRCm39) missense probably benign 0.01
R4756:C6 UTSW 15 4,811,394 (GRCm39) missense probably benign
R4879:C6 UTSW 15 4,833,129 (GRCm39) splice site probably null
R5452:C6 UTSW 15 4,844,311 (GRCm39) missense possibly damaging 0.51
R5538:C6 UTSW 15 4,844,311 (GRCm39) missense possibly damaging 0.84
R5547:C6 UTSW 15 4,837,970 (GRCm39) missense probably benign 0.00
R5790:C6 UTSW 15 4,792,968 (GRCm39) missense probably damaging 1.00
R5862:C6 UTSW 15 4,764,745 (GRCm39) missense possibly damaging 0.66
R5946:C6 UTSW 15 4,837,996 (GRCm39) missense possibly damaging 0.96
R6049:C6 UTSW 15 4,764,654 (GRCm39) missense probably damaging 1.00
R6247:C6 UTSW 15 4,793,023 (GRCm39) missense probably damaging 1.00
R6438:C6 UTSW 15 4,826,465 (GRCm39) missense possibly damaging 0.94
R6873:C6 UTSW 15 4,820,461 (GRCm39) missense probably benign 0.03
R7052:C6 UTSW 15 4,763,177 (GRCm39) missense probably damaging 0.97
R7302:C6 UTSW 15 4,826,432 (GRCm39) missense probably damaging 1.00
R7361:C6 UTSW 15 4,826,404 (GRCm39) nonsense probably null
R7481:C6 UTSW 15 4,844,357 (GRCm39) missense
R7492:C6 UTSW 15 4,761,196 (GRCm39) missense probably benign 0.00
R7498:C6 UTSW 15 4,792,846 (GRCm39) missense probably damaging 1.00
R7569:C6 UTSW 15 4,819,063 (GRCm39) missense probably benign 0.01
R7653:C6 UTSW 15 4,844,244 (GRCm39) missense
R7666:C6 UTSW 15 4,818,987 (GRCm39) missense probably damaging 0.99
R7843:C6 UTSW 15 4,837,886 (GRCm39) missense
R8073:C6 UTSW 15 4,764,675 (GRCm39) missense probably benign 0.30
R8784:C6 UTSW 15 4,822,622 (GRCm39) missense probably damaging 1.00
R8825:C6 UTSW 15 4,761,170 (GRCm39) missense possibly damaging 0.79
R8878:C6 UTSW 15 4,826,454 (GRCm39) missense probably benign 0.30
R8987:C6 UTSW 15 4,844,344 (GRCm39) missense
R9088:C6 UTSW 15 4,792,956 (GRCm39) missense probably damaging 1.00
R9216:C6 UTSW 15 4,820,465 (GRCm39) missense probably damaging 1.00
R9253:C6 UTSW 15 4,764,679 (GRCm39) missense probably benign 0.00
R9288:C6 UTSW 15 4,835,532 (GRCm39) missense
R9517:C6 UTSW 15 4,827,914 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGGAGACCATGTTGCC -3'
(R):5'- AACCTGCTACTTAGTGAGTTAAGG -3'

Sequencing Primer
(F):5'- GAGACCATGTTGCCCAAGTCTC -3'
(R):5'- CTACTTAGTGAGTTAAGGGTAGTAGC -3'
Posted On 2021-04-30