Mutagenetix > Incidental Mutation

Incidental Mutation 'R8814:Mroh2b'

672631

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R8814 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 4941625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 1037 (L1037F)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045736
AA Change: L1037F

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: L1037F

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	C	6: 129,325,604		probably benign	Het
Brd7	A	G	8: 88,345,154	V361A	probably benign	Het
C6	A	T	15: 4,792,784	Q595L	probably benign	Het
Cacna2d3	T	A	14: 29,097,815	Y532F	probably damaging	Het
Cep85l	A	T	10: 53,348,969	Y175N	probably benign	Het
Clca3a2	G	T	3: 144,797,764	N808K	probably benign	Het
Cpsf4	T	G	5: 145,178,868	S201R	probably benign	Het
Crispld2	A	G	8: 120,015,345	H144R	possibly damaging	Het
Cyp1b1	T	C	17: 79,713,359	E318G	probably benign	Het
Fam109a	G	T	5: 121,853,045	V157L	probably benign	Het
Fer1l4	A	G	2: 156,052,243	F47L	probably benign	Het
Flnb	A	G	14: 7,927,409	D1873G	probably damaging	Het
Gm47995	A	G	1: 151,198,988	M181V	probably benign	Het
Hace1	A	G	10: 45,652,701	Y346C	probably damaging	Het
Hemgn	G	T	4: 46,400,717	Q48K	possibly damaging	Het
Hhip	T	C	8: 80,051,472	D143G	probably damaging	Het
Ift74	C	T	4: 94,662,636	Q342*	probably null	Het
Kng2	A	T	16: 23,004,011	I197N	probably benign	Het
Lcat	G	A	8: 105,941,970	P167S	probably damaging	Het
Lmntd2	G	A	7: 141,210,084	R672W	probably damaging	Het
Msh4	A	G	3: 153,872,320	S640P	probably damaging	Het
Mterf1b	T	C	5: 4,197,456	S366P	probably damaging	Het
Nrxn1	A	T	17: 90,630,101	C643S	probably damaging	Het
Olfr1164	T	A	2: 88,092,971	I322F	probably benign	Het
Olfr1496	T	A	19: 13,781,533	I305N	possibly damaging	Het
Olfr485	T	A	7: 108,159,065	K269N	probably benign	Het
Olfr605	A	G	7: 103,442,913	V70A	probably benign	Het
Olfr709-ps1	T	A	7: 106,926,818	I214F	probably damaging	Het
Pask	C	A	1: 93,320,585	R998L	probably benign	Het
Pcdh8	A	G	14: 79,768,897	L742P	probably benign	Het
Psma3	A	G	12: 70,978,806	E32G	probably benign	Het
Samd11	T	C	4: 156,247,884	E500G	probably benign	Het
Scarb1	A	T	5: 125,294,092	D305E	probably benign	Het
Serpinb6b	A	G	13: 32,978,304	H362R	possibly damaging	Het
Siglec1	G	A	2: 131,072,744	T1484M	probably damaging	Het
Slfn8	A	G	11: 83,016,679	V346A	possibly damaging	Het
Slitrk6	G	C	14: 110,749,938	A779G	probably benign	Het
Soga1	C	T	2: 157,030,531	W965*	probably null	Het
Sub1	A	C	15: 11,984,231	V124G	probably damaging	Het
Tbc1d32	A	G	10: 56,196,592	I277T	possibly damaging	Het
Tln2	C	A	9: 67,221,411	E1465D	possibly damaging	Het
Trappc10	A	G	10: 78,202,919	Y780H	probably damaging	Het
Trim28	T	A	7: 13,028,527	N359K	probably damaging	Het
Tspan15	G	A	10: 62,188,056	T281M	probably benign	Het
Uaca	A	G	9: 60,866,398	N396D	possibly damaging	Het
Vmn1r84	A	G	7: 12,362,458	S103P	probably damaging	Het
Vmn2r22	C	G	6: 123,637,830	R267T	probably damaging	Het
Vmn2r7	A	G	3: 64,716,563	I112T	probably benign	Het
Vmn2r70	T	A	7: 85,565,961	I122F	probably benign	Het
Vmn2r79	C	G	7: 87,002,506	T371S	probably benign	Het
Vps8	T	C	16: 21,576,650	L1230P	probably damaging	Het
Zfp26	A	T	9: 20,438,434	V278D	probably benign	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8910:Mroh2b	UTSW	15	4931373	missense	probably benign	0.01
R8913:Mroh2b	UTSW	15	4917528	intron	probably benign
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9429:Mroh2b	UTSW	15	4934425	missense	probably damaging	1.00
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
R9443:Mroh2b	UTSW	15	4944339	missense	probably damaging	1.00
R9447:Mroh2b	UTSW	15	4931341	missense	probably damaging	1.00
R9497:Mroh2b	UTSW	15	4921363	missense	probably damaging	0.98
R9588:Mroh2b	UTSW	15	4948648	missense	probably benign	0.00
R9631:Mroh2b	UTSW	15	4917074	missense	probably damaging	0.97
R9686:Mroh2b	UTSW	15	4945123	missense	probably benign	0.34
R9774:Mroh2b	UTSW	15	4914131	missense	probably benign	0.08
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACCCCAGCCACAGGTTTAG -3'
(R):5'- AGATTTAGCTAGACCACTCATCC -3'

Sequencing Primer
(F):5'- CCCAGCCACAGGTTTAGGTATGTAG -3'
(R):5'- AGCTAGACCACTCATCCTTGTTAAC -3'

Posted On

2021-04-30