Incidental Mutation 'R8814:Mroh2b'
ID 672631
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Name maestro heat-like repeat family member 2B
Synonyms 4930455B06Rik, Heatr7b2
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 4928219-4991687 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 4971107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 1037 (L1037F)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
AlphaFold Q7M6Y6
Predicted Effect possibly damaging
Transcript: ENSMUST00000045736
AA Change: L1037F

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: L1037F

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4,928,679 (GRCm39) missense probably benign
IGL00507:Mroh2b APN 15 4,991,609 (GRCm39) missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4,960,798 (GRCm39) missense probably benign 0.35
IGL00902:Mroh2b APN 15 4,944,704 (GRCm39) missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4,980,609 (GRCm39) splice site probably benign
IGL00954:Mroh2b APN 15 4,932,536 (GRCm39) missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4,971,024 (GRCm39) missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4,944,634 (GRCm39) missense probably benign 0.00
IGL01337:Mroh2b APN 15 4,934,506 (GRCm39) missense probably benign 0.38
IGL01780:Mroh2b APN 15 4,941,482 (GRCm39) missense probably benign 0.01
IGL01919:Mroh2b APN 15 4,953,170 (GRCm39) missense probably benign 0.10
IGL02069:Mroh2b APN 15 4,933,806 (GRCm39) splice site probably benign
IGL02146:Mroh2b APN 15 4,980,776 (GRCm39) splice site probably null
IGL02221:Mroh2b APN 15 4,953,123 (GRCm39) missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4,981,745 (GRCm39) missense probably benign 0.04
IGL02350:Mroh2b APN 15 4,941,482 (GRCm39) missense probably benign 0.01
IGL02357:Mroh2b APN 15 4,941,482 (GRCm39) missense probably benign 0.01
IGL02401:Mroh2b APN 15 4,929,983 (GRCm39) missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4,981,042 (GRCm39) splice site probably benign
IGL02432:Mroh2b APN 15 4,943,668 (GRCm39) missense probably benign
IGL02582:Mroh2b APN 15 4,937,997 (GRCm39) missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4,960,583 (GRCm39) missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4,935,114 (GRCm39) missense probably benign
IGL02811:Mroh2b APN 15 4,944,718 (GRCm39) missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4,991,630 (GRCm39) missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4,973,854 (GRCm39) missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4,942,294 (GRCm39) missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4,955,109 (GRCm39) missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4,960,600 (GRCm39) missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4,971,116 (GRCm39) missense probably benign 0.01
R0530:Mroh2b UTSW 15 4,963,877 (GRCm39) missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4,947,799 (GRCm39) missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4,978,137 (GRCm39) missense probably benign 0.00
R1525:Mroh2b UTSW 15 4,980,612 (GRCm39) splice site probably null
R1584:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4,974,572 (GRCm39) missense probably benign 0.08
R1657:Mroh2b UTSW 15 4,960,525 (GRCm39) nonsense probably null
R1671:Mroh2b UTSW 15 4,980,776 (GRCm39) splice site probably null
R1698:Mroh2b UTSW 15 4,943,622 (GRCm39) missense probably benign 0.02
R2002:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4,946,640 (GRCm39) missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4,974,448 (GRCm39) missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4,950,928 (GRCm39) critical splice donor site probably null
R2183:Mroh2b UTSW 15 4,947,707 (GRCm39) splice site probably null
R3713:Mroh2b UTSW 15 4,973,131 (GRCm39) missense probably benign 0.01
R3714:Mroh2b UTSW 15 4,973,131 (GRCm39) missense probably benign 0.01
R3747:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3748:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3749:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3750:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3792:Mroh2b UTSW 15 4,953,102 (GRCm39) missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4,954,543 (GRCm39) nonsense probably null
R4021:Mroh2b UTSW 15 4,954,582 (GRCm39) missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4,960,861 (GRCm39) missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4,977,407 (GRCm39) missense probably benign 0.21
R4592:Mroh2b UTSW 15 4,947,772 (GRCm39) missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4,933,752 (GRCm39) missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4,929,932 (GRCm39) missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4,971,004 (GRCm39) missense probably benign 0.07
R5342:Mroh2b UTSW 15 4,943,615 (GRCm39) nonsense probably null
R5353:Mroh2b UTSW 15 4,946,660 (GRCm39) missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4,935,054 (GRCm39) missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4,971,094 (GRCm39) missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4,938,463 (GRCm39) missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4,942,366 (GRCm39) splice site probably null
R6046:Mroh2b UTSW 15 4,980,763 (GRCm39) missense probably benign 0.01
R6081:Mroh2b UTSW 15 4,973,859 (GRCm39) missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4,944,707 (GRCm39) missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4,947,832 (GRCm39) missense probably benign 0.23
R6240:Mroh2b UTSW 15 4,964,126 (GRCm39) missense probably benign 0.38
R6487:Mroh2b UTSW 15 4,976,721 (GRCm39) missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4,935,056 (GRCm39) missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4,982,764 (GRCm39) missense probably benign 0.36
R6663:Mroh2b UTSW 15 4,977,417 (GRCm39) missense probably benign 0.21
R6820:Mroh2b UTSW 15 4,982,756 (GRCm39) missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4,938,469 (GRCm39) missense probably benign 0.00
R6990:Mroh2b UTSW 15 4,942,284 (GRCm39) missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4,929,986 (GRCm39) missense probably benign 0.35
R7092:Mroh2b UTSW 15 4,964,160 (GRCm39) missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4,977,485 (GRCm39) missense probably benign 0.06
R7264:Mroh2b UTSW 15 4,950,844 (GRCm39) missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4,971,036 (GRCm39) missense probably benign 0.21
R7462:Mroh2b UTSW 15 4,938,109 (GRCm39) missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4,978,491 (GRCm39) missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4,964,087 (GRCm39) missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4,960,543 (GRCm39) missense probably benign 0.09
R7605:Mroh2b UTSW 15 4,974,505 (GRCm39) missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4,946,613 (GRCm39) missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4,978,587 (GRCm39) missense probably benign 0.36
R7848:Mroh2b UTSW 15 4,967,861 (GRCm39) nonsense probably null
R7952:Mroh2b UTSW 15 4,980,693 (GRCm39) missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4,950,839 (GRCm39) nonsense probably null
R8088:Mroh2b UTSW 15 4,929,985 (GRCm39) missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4,967,892 (GRCm39) missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4,938,522 (GRCm39) missense probably benign 0.04
R8248:Mroh2b UTSW 15 4,960,586 (GRCm39) missense probably benign 0.40
R8258:Mroh2b UTSW 15 4,941,391 (GRCm39) missense probably benign 0.01
R8259:Mroh2b UTSW 15 4,941,391 (GRCm39) missense probably benign 0.01
R8304:Mroh2b UTSW 15 4,955,119 (GRCm39) missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4,980,746 (GRCm39) nonsense probably null
R8345:Mroh2b UTSW 15 4,973,808 (GRCm39) missense probably benign 0.09
R8507:Mroh2b UTSW 15 4,978,572 (GRCm39) missense probably damaging 1.00
R8728:Mroh2b UTSW 15 4,935,122 (GRCm39) missense probably damaging 1.00
R8747:Mroh2b UTSW 15 4,964,782 (GRCm39) missense probably damaging 0.99
R8798:Mroh2b UTSW 15 4,978,191 (GRCm39) missense probably damaging 1.00
R8856:Mroh2b UTSW 15 4,960,510 (GRCm39) nonsense probably null
R8910:Mroh2b UTSW 15 4,960,855 (GRCm39) missense probably benign 0.01
R8913:Mroh2b UTSW 15 4,947,010 (GRCm39) intron probably benign
R8941:Mroh2b UTSW 15 4,991,606 (GRCm39) missense possibly damaging 0.86
R9014:Mroh2b UTSW 15 4,928,670 (GRCm39) start codon destroyed probably null 0.95
R9086:Mroh2b UTSW 15 4,982,754 (GRCm39) critical splice acceptor site probably null
R9101:Mroh2b UTSW 15 4,929,935 (GRCm39) missense probably benign 0.20
R9118:Mroh2b UTSW 15 4,991,573 (GRCm39) missense possibly damaging 0.86
R9393:Mroh2b UTSW 15 4,980,666 (GRCm39) missense probably benign
R9429:Mroh2b UTSW 15 4,963,907 (GRCm39) missense probably damaging 1.00
R9431:Mroh2b UTSW 15 4,963,952 (GRCm39) missense probably damaging 1.00
R9443:Mroh2b UTSW 15 4,973,821 (GRCm39) missense probably damaging 1.00
R9447:Mroh2b UTSW 15 4,960,823 (GRCm39) missense probably damaging 1.00
R9497:Mroh2b UTSW 15 4,950,845 (GRCm39) missense probably damaging 0.98
R9588:Mroh2b UTSW 15 4,978,130 (GRCm39) missense probably benign 0.00
R9631:Mroh2b UTSW 15 4,946,556 (GRCm39) missense probably damaging 0.97
R9686:Mroh2b UTSW 15 4,974,605 (GRCm39) missense probably benign 0.34
R9774:Mroh2b UTSW 15 4,943,613 (GRCm39) missense probably benign 0.08
X0067:Mroh2b UTSW 15 4,981,073 (GRCm39) missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4,934,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCCAGCCACAGGTTTAG -3'
(R):5'- AGATTTAGCTAGACCACTCATCC -3'

Sequencing Primer
(F):5'- CCCAGCCACAGGTTTAGGTATGTAG -3'
(R):5'- AGCTAGACCACTCATCCTTGTTAAC -3'
Posted On 2021-04-30