Incidental Mutation 'R8814:Sub1'
ID 672632
Institutional Source Beutler Lab
Gene Symbol Sub1
Ensembl Gene ENSMUSG00000022205
Gene Name SUB1 homolog, transcriptional regulator
Synonyms P15, Pc4, Rpo2tc1
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.846) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 11981422-11996091 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 11984317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 124 (V124G)
Ref Sequence ENSEMBL: ENSMUSP00000022816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022816] [ENSMUST00000110504]
AlphaFold P11031
Predicted Effect probably damaging
Transcript: ENSMUST00000022816
AA Change: V124G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022816
Gene: ENSMUSG00000022205
AA Change: V124G

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
Pfam:PC4 62 117 5.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110504
AA Change: V124G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106130
Gene: ENSMUSG00000022205
AA Change: V124G

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
Pfam:PC4 64 116 1.9e-27 PFAM
Meta Mutation Damage Score 0.9221 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous KO is embryonic lethal. Conditional KO in the brain increases sensitivity of hippocampal neurons to hypoxia, causing changes in movement, activity and spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Sub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1244:Sub1 UTSW 15 11,991,130 (GRCm39) missense possibly damaging 0.49
R1893:Sub1 UTSW 15 11,991,130 (GRCm39) missense possibly damaging 0.49
R6415:Sub1 UTSW 15 11,986,560 (GRCm39) missense probably benign 0.01
R7090:Sub1 UTSW 15 11,986,572 (GRCm39) missense probably benign 0.00
R7269:Sub1 UTSW 15 11,993,937 (GRCm39) missense probably benign 0.23
R7729:Sub1 UTSW 15 11,986,589 (GRCm39) missense probably damaging 1.00
R9732:Sub1 UTSW 15 11,986,650 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GACTCAACAGTGTGCCTAGTTG -3'
(R):5'- TATGTGGCGTGCCTGAGATC -3'

Sequencing Primer
(F):5'- TATTTTACACACTAGGTAGGGGGCAC -3'
(R):5'- AGATCTGGGTTTTGTTCTCAACAC -3'
Posted On 2021-04-30