Mutagenetix > Incidental Mutation

Incidental Mutation 'R8814:Vps8'

672633

Institutional Source

Beutler Lab

Gene Symbol

Vps8

Ensembl Gene

ENSMUSG00000033653

Gene Name

VPS8 CORVET complex subunit

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8814 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21423118-21644680 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21576650 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1230 (L1230P)

Ref Sequence

ENSEMBL: ENSMUSP00000093905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118923]

AlphaFold

Q0P5W1

Predicted Effect

probably damaging
Transcript: ENSMUST00000096191
AA Change: L1230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653
AA Change: L1230P

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	296	1e-8	SMART
Blast:WD40	184	225	7e-22	BLAST
Blast:WD40	228	268	5e-20	BLAST
Pfam:Vps8	610	794	1.7e-61	PFAM
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1085	1097	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
Blast:RING	1257	1277	1e-5	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000096192
AA Change: L1202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: L1202P

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	1e-8	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	612	796	1.4e-61	PFAM
low complexity region	969	979	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1098	1109	N/A	INTRINSIC
RING	1229	1280	1.23e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115397
AA Change: L1232P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: L1232P

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	8e-9	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	613	796	1.3e-61	PFAM
low complexity region	994	1009	N/A	INTRINSIC
low complexity region	1087	1099	N/A	INTRINSIC
low complexity region	1128	1139	N/A	INTRINSIC
RING	1259	1310	1.23e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117598
AA Change: L1230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: L1230P

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	296	1e-8	SMART
Blast:WD40	184	225	8e-22	BLAST
Blast:WD40	228	268	5e-20	BLAST
Pfam:Vps8	610	794	1.9e-61	PFAM
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1085	1097	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
RING	1257	1308	1.23e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000118923
AA Change: L1202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: L1202P

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	9e-9	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	612	796	1.9e-61	PFAM
low complexity region	969	979	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1098	1109	N/A	INTRINSIC
RING	1229	1280	1.23e-4	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653
AA Change: L800P

Domain	Start	End	E-Value	Type
Pfam:Vps8	182	365	8.5e-62	PFAM
low complexity region	563	578	N/A	INTRINSIC
low complexity region	656	668	N/A	INTRINSIC
low complexity region	697	708	N/A	INTRINSIC
RING	828	879	1.23e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	C	6: 129,325,604		probably benign	Het
Brd7	A	G	8: 88,345,154	V361A	probably benign	Het
C6	A	T	15: 4,792,784	Q595L	probably benign	Het
Cacna2d3	T	A	14: 29,097,815	Y532F	probably damaging	Het
Cep85l	A	T	10: 53,348,969	Y175N	probably benign	Het
Clca3a2	G	T	3: 144,797,764	N808K	probably benign	Het
Cpsf4	T	G	5: 145,178,868	S201R	probably benign	Het
Crispld2	A	G	8: 120,015,345	H144R	possibly damaging	Het
Cyp1b1	T	C	17: 79,713,359	E318G	probably benign	Het
Fam109a	G	T	5: 121,853,045	V157L	probably benign	Het
Fer1l4	A	G	2: 156,052,243	F47L	probably benign	Het
Flnb	A	G	14: 7,927,409	D1873G	probably damaging	Het
Gm47995	A	G	1: 151,198,988	M181V	probably benign	Het
Hace1	A	G	10: 45,652,701	Y346C	probably damaging	Het
Hemgn	G	T	4: 46,400,717	Q48K	possibly damaging	Het
Hhip	T	C	8: 80,051,472	D143G	probably damaging	Het
Ift74	C	T	4: 94,662,636	Q342*	probably null	Het
Kng2	A	T	16: 23,004,011	I197N	probably benign	Het
Lcat	G	A	8: 105,941,970	P167S	probably damaging	Het
Lmntd2	G	A	7: 141,210,084	R672W	probably damaging	Het
Mroh2b	G	T	15: 4,941,625	L1037F	possibly damaging	Het
Msh4	A	G	3: 153,872,320	S640P	probably damaging	Het
Mterf1b	T	C	5: 4,197,456	S366P	probably damaging	Het
Nrxn1	A	T	17: 90,630,101	C643S	probably damaging	Het
Olfr1164	T	A	2: 88,092,971	I322F	probably benign	Het
Olfr1496	T	A	19: 13,781,533	I305N	possibly damaging	Het
Olfr485	T	A	7: 108,159,065	K269N	probably benign	Het
Olfr605	A	G	7: 103,442,913	V70A	probably benign	Het
Olfr709-ps1	T	A	7: 106,926,818	I214F	probably damaging	Het
Pask	C	A	1: 93,320,585	R998L	probably benign	Het
Pcdh8	A	G	14: 79,768,897	L742P	probably benign	Het
Psma3	A	G	12: 70,978,806	E32G	probably benign	Het
Samd11	T	C	4: 156,247,884	E500G	probably benign	Het
Scarb1	A	T	5: 125,294,092	D305E	probably benign	Het
Serpinb6b	A	G	13: 32,978,304	H362R	possibly damaging	Het
Siglec1	G	A	2: 131,072,744	T1484M	probably damaging	Het
Slfn8	A	G	11: 83,016,679	V346A	possibly damaging	Het
Slitrk6	G	C	14: 110,749,938	A779G	probably benign	Het
Soga1	C	T	2: 157,030,531	W965*	probably null	Het
Sub1	A	C	15: 11,984,231	V124G	probably damaging	Het
Tbc1d32	A	G	10: 56,196,592	I277T	possibly damaging	Het
Tln2	C	A	9: 67,221,411	E1465D	possibly damaging	Het
Trappc10	A	G	10: 78,202,919	Y780H	probably damaging	Het
Trim28	T	A	7: 13,028,527	N359K	probably damaging	Het
Tspan15	G	A	10: 62,188,056	T281M	probably benign	Het
Uaca	A	G	9: 60,866,398	N396D	possibly damaging	Het
Vmn1r84	A	G	7: 12,362,458	S103P	probably damaging	Het
Vmn2r22	C	G	6: 123,637,830	R267T	probably damaging	Het
Vmn2r7	A	G	3: 64,716,563	I112T	probably benign	Het
Vmn2r70	T	A	7: 85,565,961	I122F	probably benign	Het
Vmn2r79	C	G	7: 87,002,506	T371S	probably benign	Het
Zfp26	A	T	9: 20,438,434	V278D	probably benign	Het

Other mutations in Vps8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Vps8	APN	16	21442334	missense	possibly damaging	0.47
IGL00596:Vps8	APN	16	21448412	splice site	probably benign
IGL00985:Vps8	APN	16	21477584	splice site	probably benign
IGL01356:Vps8	APN	16	21517357	critical splice donor site	probably null
IGL01375:Vps8	APN	16	21559372	nonsense	probably null
IGL01643:Vps8	APN	16	21518222	missense	possibly damaging	0.92
IGL02159:Vps8	APN	16	21466484	missense	possibly damaging	0.69
IGL02214:Vps8	APN	16	21517285	missense	probably damaging	1.00
IGL02465:Vps8	APN	16	21521903	missense	probably damaging	1.00
IGL02651:Vps8	APN	16	21517336	missense	probably damaging	0.99
IGL03174:Vps8	APN	16	21466463	missense	probably damaging	1.00
IGL03337:Vps8	APN	16	21563168	missense	probably benign
IGL03383:Vps8	APN	16	21435823	critical splice donor site	probably null
IGL03402:Vps8	APN	16	21448398	missense	possibly damaging	0.68
empires	UTSW	16	21581548	nonsense	probably null
porky	UTSW	16	21461238	missense	probably benign	0.32
realm	UTSW	16	21545236	intron	probably benign
realms	UTSW	16	21444188	splice site	probably null
Reich	UTSW	16	21478439	missense	probably benign	0.29
reichen	UTSW	16	21506825	splice site	probably benign
IGL03052:Vps8	UTSW	16	21448365	missense	probably damaging	0.99
PIT4677001:Vps8	UTSW	16	21500334	missense	possibly damaging	0.94
R0066:Vps8	UTSW	16	21477523	missense	possibly damaging	0.77
R0066:Vps8	UTSW	16	21477523	missense	possibly damaging	0.77
R0125:Vps8	UTSW	16	21470154	missense	probably benign	0.00
R0137:Vps8	UTSW	16	21504386	splice site	probably benign
R0362:Vps8	UTSW	16	21608227	intron	probably benign
R0384:Vps8	UTSW	16	21506825	splice site	probably benign
R0492:Vps8	UTSW	16	21442357	missense	probably damaging	1.00
R0525:Vps8	UTSW	16	21540109	critical splice donor site	probably null
R0531:Vps8	UTSW	16	21459811	intron	probably benign
R0605:Vps8	UTSW	16	21559337	missense	probably benign	0.00
R0636:Vps8	UTSW	16	21434933	missense	probably benign	0.32
R0707:Vps8	UTSW	16	21442357	missense	probably damaging	1.00
R0840:Vps8	UTSW	16	21456321	missense	probably damaging	0.99
R1170:Vps8	UTSW	16	21459820	intron	probably benign
R1203:Vps8	UTSW	16	21511557	missense	probably damaging	1.00
R1482:Vps8	UTSW	16	21581598	missense	probably benign	0.00
R1531:Vps8	UTSW	16	21466476	nonsense	probably null
R1642:Vps8	UTSW	16	21581579	missense	probably benign
R1956:Vps8	UTSW	16	21461142	missense	probably damaging	1.00
R2201:Vps8	UTSW	16	21576757	missense	probably damaging	1.00
R2287:Vps8	UTSW	16	21568413	missense	probably damaging	1.00
R2423:Vps8	UTSW	16	21559337	missense	probably benign	0.00
R3151:Vps8	UTSW	16	21442373	missense	probably benign	0.04
R3943:Vps8	UTSW	16	21470123	missense	probably damaging	1.00
R3944:Vps8	UTSW	16	21470123	missense	probably damaging	1.00
R4043:Vps8	UTSW	16	21526396	missense	probably damaging	1.00
R4302:Vps8	UTSW	16	21495914	missense	probably damaging	1.00
R4398:Vps8	UTSW	16	21504466	missense	probably damaging	1.00
R4477:Vps8	UTSW	16	21545236	intron	probably benign
R4478:Vps8	UTSW	16	21545236	intron	probably benign
R4479:Vps8	UTSW	16	21545236	intron	probably benign
R4480:Vps8	UTSW	16	21545236	intron	probably benign
R4571:Vps8	UTSW	16	21435775	missense	probably damaging	1.00
R4653:Vps8	UTSW	16	21500210	missense	probably damaging	1.00
R4664:Vps8	UTSW	16	21444188	splice site	probably null
R4713:Vps8	UTSW	16	21442439	missense	probably damaging	1.00
R4726:Vps8	UTSW	16	21448404	splice site	probably null
R4959:Vps8	UTSW	16	21459786	missense	probably damaging	1.00
R4973:Vps8	UTSW	16	21459786	missense	probably damaging	1.00
R4975:Vps8	UTSW	16	21466469	missense	probably damaging	1.00
R4992:Vps8	UTSW	16	21461408	missense	possibly damaging	0.52
R5144:Vps8	UTSW	16	21559353	missense	probably damaging	1.00
R5168:Vps8	UTSW	16	21457445	missense	probably damaging	0.99
R5168:Vps8	UTSW	16	21533099	missense	probably benign	0.05
R5222:Vps8	UTSW	16	21581548	nonsense	probably null
R5231:Vps8	UTSW	16	21576725	missense	probably damaging	1.00
R5876:Vps8	UTSW	16	21461439	critical splice donor site	probably null
R5963:Vps8	UTSW	16	21470121	missense	possibly damaging	0.48
R6010:Vps8	UTSW	16	21545205	intron	probably benign
R6023:Vps8	UTSW	16	21461238	missense	probably benign	0.32
R6173:Vps8	UTSW	16	21495932	splice site	probably null
R6185:Vps8	UTSW	16	21470141	missense	probably damaging	0.98
R6264:Vps8	UTSW	16	21559349	nonsense	probably null
R6409:Vps8	UTSW	16	21478439	missense	probably benign	0.29
R6522:Vps8	UTSW	16	21442379	missense	probably damaging	0.99
R6528:Vps8	UTSW	16	21554125	nonsense	probably null
R6784:Vps8	UTSW	16	21563207	missense	probably benign	0.01
R7040:Vps8	UTSW	16	21575022	missense	probably damaging	1.00
R7072:Vps8	UTSW	16	21581579	missense	probably benign
R7103:Vps8	UTSW	16	21526441	missense	probably damaging	1.00
R7149:Vps8	UTSW	16	21459776	missense	probably damaging	1.00
R7195:Vps8	UTSW	16	21456282	missense	probably damaging	1.00
R7206:Vps8	UTSW	16	21457421	missense	probably damaging	1.00
R7403:Vps8	UTSW	16	21434972	missense	possibly damaging	0.78
R7782:Vps8	UTSW	16	21511558	missense	possibly damaging	0.89
R7806:Vps8	UTSW	16	21459751	missense	probably damaging	1.00
R7846:Vps8	UTSW	16	21532320	missense	probably benign	0.01
R7943:Vps8	UTSW	16	21477872	missense	possibly damaging	0.66
R8075:Vps8	UTSW	16	21521894	missense	probably damaging	0.99
R8190:Vps8	UTSW	16	21575030	missense	possibly damaging	0.73
R8307:Vps8	UTSW	16	21495902	missense	probably benign	0.02
R8483:Vps8	UTSW	16	21575013	missense	probably damaging	0.98
R9064:Vps8	UTSW	16	21470229	missense	probably damaging	1.00
R9367:Vps8	UTSW	16	21521918	missense	possibly damaging	0.45
R9404:Vps8	UTSW	16	21608177	missense	probably benign	0.12
R9544:Vps8	UTSW	16	21518143	missense	probably benign	0.00
R9570:Vps8	UTSW	16	21644203	missense	probably benign	0.10
R9634:Vps8	UTSW	16	21554143	missense	probably damaging	1.00
R9702:Vps8	UTSW	16	21644133	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AGGCTTGAGCATCTCAGTG -3'
(R):5'- TGTACTACTGCCTGGCTACC -3'

Sequencing Primer
(F):5'- GAGCATCTCAGTGTCCGAATC -3'
(R):5'- CACGGCCCCGAGAGTTAG -3'

Posted On

2021-04-30