Incidental Mutation 'R8814:Vps8'
ID 672633
Institutional Source Beutler Lab
Gene Symbol Vps8
Ensembl Gene ENSMUSG00000033653
Gene Name VPS8 CORVET complex subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 21423118-21644680 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21576650 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1230 (L1230P)
Ref Sequence ENSEMBL: ENSMUSP00000093905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118923]
AlphaFold Q0P5W1
Predicted Effect probably damaging
Transcript: ENSMUST00000096191
AA Change: L1230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653
AA Change: L1230P

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 7e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.7e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
Blast:RING 1257 1277 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000096192
AA Change: L1202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: L1202P

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 1e-8 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.4e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115397
AA Change: L1232P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: L1232P

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 8e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 613 796 1.3e-61 PFAM
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1087 1099 N/A INTRINSIC
low complexity region 1128 1139 N/A INTRINSIC
RING 1259 1310 1.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117598
AA Change: L1230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: L1230P

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 8e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.9e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
RING 1257 1308 1.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118923
AA Change: L1202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: L1202P

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 9e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.9e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653
AA Change: L800P

DomainStartEndE-ValueType
Pfam:Vps8 182 365 8.5e-62 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
RING 828 879 1.23e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
Brd7 A G 8: 88,345,154 V361A probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cacna2d3 T A 14: 29,097,815 Y532F probably damaging Het
Cep85l A T 10: 53,348,969 Y175N probably benign Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Crispld2 A G 8: 120,015,345 H144R possibly damaging Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hace1 A G 10: 45,652,701 Y346C probably damaging Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Mterf1b T C 5: 4,197,456 S366P probably damaging Het
Nrxn1 A T 17: 90,630,101 C643S probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr485 T A 7: 108,159,065 K269N probably benign Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Scarb1 A T 5: 125,294,092 D305E probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slfn8 A G 11: 83,016,679 V346A possibly damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Soga1 C T 2: 157,030,531 W965* probably null Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Uaca A G 9: 60,866,398 N396D possibly damaging Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Vps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Vps8 APN 16 21442334 missense possibly damaging 0.47
IGL00596:Vps8 APN 16 21448412 splice site probably benign
IGL00985:Vps8 APN 16 21477584 splice site probably benign
IGL01356:Vps8 APN 16 21517357 critical splice donor site probably null
IGL01375:Vps8 APN 16 21559372 nonsense probably null
IGL01643:Vps8 APN 16 21518222 missense possibly damaging 0.92
IGL02159:Vps8 APN 16 21466484 missense possibly damaging 0.69
IGL02214:Vps8 APN 16 21517285 missense probably damaging 1.00
IGL02465:Vps8 APN 16 21521903 missense probably damaging 1.00
IGL02651:Vps8 APN 16 21517336 missense probably damaging 0.99
IGL03174:Vps8 APN 16 21466463 missense probably damaging 1.00
IGL03337:Vps8 APN 16 21563168 missense probably benign
IGL03383:Vps8 APN 16 21435823 critical splice donor site probably null
IGL03402:Vps8 APN 16 21448398 missense possibly damaging 0.68
empires UTSW 16 21581548 nonsense probably null
porky UTSW 16 21461238 missense probably benign 0.32
realm UTSW 16 21545236 intron probably benign
realms UTSW 16 21444188 splice site probably null
Reich UTSW 16 21478439 missense probably benign 0.29
reichen UTSW 16 21506825 splice site probably benign
IGL03052:Vps8 UTSW 16 21448365 missense probably damaging 0.99
PIT4677001:Vps8 UTSW 16 21500334 missense possibly damaging 0.94
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0125:Vps8 UTSW 16 21470154 missense probably benign 0.00
R0137:Vps8 UTSW 16 21504386 splice site probably benign
R0362:Vps8 UTSW 16 21608227 intron probably benign
R0384:Vps8 UTSW 16 21506825 splice site probably benign
R0492:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0525:Vps8 UTSW 16 21540109 critical splice donor site probably null
R0531:Vps8 UTSW 16 21459811 intron probably benign
R0605:Vps8 UTSW 16 21559337 missense probably benign 0.00
R0636:Vps8 UTSW 16 21434933 missense probably benign 0.32
R0707:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0840:Vps8 UTSW 16 21456321 missense probably damaging 0.99
R1170:Vps8 UTSW 16 21459820 intron probably benign
R1203:Vps8 UTSW 16 21511557 missense probably damaging 1.00
R1482:Vps8 UTSW 16 21581598 missense probably benign 0.00
R1531:Vps8 UTSW 16 21466476 nonsense probably null
R1642:Vps8 UTSW 16 21581579 missense probably benign
R1956:Vps8 UTSW 16 21461142 missense probably damaging 1.00
R2201:Vps8 UTSW 16 21576757 missense probably damaging 1.00
R2287:Vps8 UTSW 16 21568413 missense probably damaging 1.00
R2423:Vps8 UTSW 16 21559337 missense probably benign 0.00
R3151:Vps8 UTSW 16 21442373 missense probably benign 0.04
R3943:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R3944:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R4043:Vps8 UTSW 16 21526396 missense probably damaging 1.00
R4302:Vps8 UTSW 16 21495914 missense probably damaging 1.00
R4398:Vps8 UTSW 16 21504466 missense probably damaging 1.00
R4477:Vps8 UTSW 16 21545236 intron probably benign
R4478:Vps8 UTSW 16 21545236 intron probably benign
R4479:Vps8 UTSW 16 21545236 intron probably benign
R4480:Vps8 UTSW 16 21545236 intron probably benign
R4571:Vps8 UTSW 16 21435775 missense probably damaging 1.00
R4653:Vps8 UTSW 16 21500210 missense probably damaging 1.00
R4664:Vps8 UTSW 16 21444188 splice site probably null
R4713:Vps8 UTSW 16 21442439 missense probably damaging 1.00
R4726:Vps8 UTSW 16 21448404 splice site probably null
R4959:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4973:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4975:Vps8 UTSW 16 21466469 missense probably damaging 1.00
R4992:Vps8 UTSW 16 21461408 missense possibly damaging 0.52
R5144:Vps8 UTSW 16 21559353 missense probably damaging 1.00
R5168:Vps8 UTSW 16 21457445 missense probably damaging 0.99
R5168:Vps8 UTSW 16 21533099 missense probably benign 0.05
R5222:Vps8 UTSW 16 21581548 nonsense probably null
R5231:Vps8 UTSW 16 21576725 missense probably damaging 1.00
R5876:Vps8 UTSW 16 21461439 critical splice donor site probably null
R5963:Vps8 UTSW 16 21470121 missense possibly damaging 0.48
R6010:Vps8 UTSW 16 21545205 intron probably benign
R6023:Vps8 UTSW 16 21461238 missense probably benign 0.32
R6173:Vps8 UTSW 16 21495932 splice site probably null
R6185:Vps8 UTSW 16 21470141 missense probably damaging 0.98
R6264:Vps8 UTSW 16 21559349 nonsense probably null
R6409:Vps8 UTSW 16 21478439 missense probably benign 0.29
R6522:Vps8 UTSW 16 21442379 missense probably damaging 0.99
R6528:Vps8 UTSW 16 21554125 nonsense probably null
R6784:Vps8 UTSW 16 21563207 missense probably benign 0.01
R7040:Vps8 UTSW 16 21575022 missense probably damaging 1.00
R7072:Vps8 UTSW 16 21581579 missense probably benign
R7103:Vps8 UTSW 16 21526441 missense probably damaging 1.00
R7149:Vps8 UTSW 16 21459776 missense probably damaging 1.00
R7195:Vps8 UTSW 16 21456282 missense probably damaging 1.00
R7206:Vps8 UTSW 16 21457421 missense probably damaging 1.00
R7403:Vps8 UTSW 16 21434972 missense possibly damaging 0.78
R7782:Vps8 UTSW 16 21511558 missense possibly damaging 0.89
R7806:Vps8 UTSW 16 21459751 missense probably damaging 1.00
R7846:Vps8 UTSW 16 21532320 missense probably benign 0.01
R7943:Vps8 UTSW 16 21477872 missense possibly damaging 0.66
R8075:Vps8 UTSW 16 21521894 missense probably damaging 0.99
R8190:Vps8 UTSW 16 21575030 missense possibly damaging 0.73
R8307:Vps8 UTSW 16 21495902 missense probably benign 0.02
R8483:Vps8 UTSW 16 21575013 missense probably damaging 0.98
R9064:Vps8 UTSW 16 21470229 missense probably damaging 1.00
R9367:Vps8 UTSW 16 21521918 missense possibly damaging 0.45
R9404:Vps8 UTSW 16 21608177 missense probably benign 0.12
R9544:Vps8 UTSW 16 21518143 missense probably benign 0.00
R9570:Vps8 UTSW 16 21644203 missense probably benign 0.10
R9634:Vps8 UTSW 16 21554143 missense probably damaging 1.00
R9702:Vps8 UTSW 16 21644133 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGGCTTGAGCATCTCAGTG -3'
(R):5'- TGTACTACTGCCTGGCTACC -3'

Sequencing Primer
(F):5'- GAGCATCTCAGTGTCCGAATC -3'
(R):5'- CACGGCCCCGAGAGTTAG -3'
Posted On 2021-04-30