Incidental Mutation 'R8814:Vps8'
ID 672633
Institutional Source Beutler Lab
Gene Symbol Vps8
Ensembl Gene ENSMUSG00000033653
Gene Name VPS8 CORVET complex subunit
Synonyms
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 21241868-21463430 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21395400 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1230 (L1230P)
Ref Sequence ENSEMBL: ENSMUSP00000093905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118923]
AlphaFold Q0P5W1
Predicted Effect probably damaging
Transcript: ENSMUST00000096191
AA Change: L1230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653
AA Change: L1230P

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 7e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.7e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
Blast:RING 1257 1277 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000096192
AA Change: L1202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: L1202P

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 1e-8 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.4e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115397
AA Change: L1232P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: L1232P

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 8e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 613 796 1.3e-61 PFAM
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1087 1099 N/A INTRINSIC
low complexity region 1128 1139 N/A INTRINSIC
RING 1259 1310 1.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117598
AA Change: L1230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: L1230P

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 8e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.9e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
RING 1257 1308 1.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118923
AA Change: L1202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: L1202P

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 9e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.9e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653
AA Change: L800P

DomainStartEndE-ValueType
Pfam:Vps8 182 365 8.5e-62 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
RING 828 879 1.23e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Vps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Vps8 APN 16 21,261,084 (GRCm39) missense possibly damaging 0.47
IGL00596:Vps8 APN 16 21,267,162 (GRCm39) splice site probably benign
IGL00985:Vps8 APN 16 21,296,334 (GRCm39) splice site probably benign
IGL01356:Vps8 APN 16 21,336,107 (GRCm39) critical splice donor site probably null
IGL01375:Vps8 APN 16 21,378,122 (GRCm39) nonsense probably null
IGL01643:Vps8 APN 16 21,336,972 (GRCm39) missense possibly damaging 0.92
IGL02159:Vps8 APN 16 21,285,234 (GRCm39) missense possibly damaging 0.69
IGL02214:Vps8 APN 16 21,336,035 (GRCm39) missense probably damaging 1.00
IGL02465:Vps8 APN 16 21,340,653 (GRCm39) missense probably damaging 1.00
IGL02651:Vps8 APN 16 21,336,086 (GRCm39) missense probably damaging 0.99
IGL03174:Vps8 APN 16 21,285,213 (GRCm39) missense probably damaging 1.00
IGL03337:Vps8 APN 16 21,381,918 (GRCm39) missense probably benign
IGL03383:Vps8 APN 16 21,254,573 (GRCm39) critical splice donor site probably null
IGL03402:Vps8 APN 16 21,267,148 (GRCm39) missense possibly damaging 0.68
empires UTSW 16 21,400,298 (GRCm39) nonsense probably null
porky UTSW 16 21,279,988 (GRCm39) missense probably benign 0.32
realm UTSW 16 21,363,986 (GRCm39) intron probably benign
realms UTSW 16 21,262,938 (GRCm39) splice site probably null
Reich UTSW 16 21,297,189 (GRCm39) missense probably benign 0.29
reichen UTSW 16 21,325,575 (GRCm39) splice site probably benign
IGL03052:Vps8 UTSW 16 21,267,115 (GRCm39) missense probably damaging 0.99
PIT4677001:Vps8 UTSW 16 21,319,084 (GRCm39) missense possibly damaging 0.94
R0066:Vps8 UTSW 16 21,296,273 (GRCm39) missense possibly damaging 0.77
R0066:Vps8 UTSW 16 21,296,273 (GRCm39) missense possibly damaging 0.77
R0125:Vps8 UTSW 16 21,288,904 (GRCm39) missense probably benign 0.00
R0137:Vps8 UTSW 16 21,323,136 (GRCm39) splice site probably benign
R0362:Vps8 UTSW 16 21,426,977 (GRCm39) intron probably benign
R0384:Vps8 UTSW 16 21,325,575 (GRCm39) splice site probably benign
R0492:Vps8 UTSW 16 21,261,107 (GRCm39) missense probably damaging 1.00
R0525:Vps8 UTSW 16 21,358,859 (GRCm39) critical splice donor site probably null
R0531:Vps8 UTSW 16 21,278,561 (GRCm39) intron probably benign
R0605:Vps8 UTSW 16 21,378,087 (GRCm39) missense probably benign 0.00
R0636:Vps8 UTSW 16 21,253,683 (GRCm39) missense probably benign 0.32
R0707:Vps8 UTSW 16 21,261,107 (GRCm39) missense probably damaging 1.00
R0840:Vps8 UTSW 16 21,275,071 (GRCm39) missense probably damaging 0.99
R1170:Vps8 UTSW 16 21,278,570 (GRCm39) intron probably benign
R1203:Vps8 UTSW 16 21,330,307 (GRCm39) missense probably damaging 1.00
R1482:Vps8 UTSW 16 21,400,348 (GRCm39) missense probably benign 0.00
R1531:Vps8 UTSW 16 21,285,226 (GRCm39) nonsense probably null
R1642:Vps8 UTSW 16 21,400,329 (GRCm39) missense probably benign
R1956:Vps8 UTSW 16 21,279,892 (GRCm39) missense probably damaging 1.00
R2201:Vps8 UTSW 16 21,395,507 (GRCm39) missense probably damaging 1.00
R2287:Vps8 UTSW 16 21,387,163 (GRCm39) missense probably damaging 1.00
R2423:Vps8 UTSW 16 21,378,087 (GRCm39) missense probably benign 0.00
R3151:Vps8 UTSW 16 21,261,123 (GRCm39) missense probably benign 0.04
R3943:Vps8 UTSW 16 21,288,873 (GRCm39) missense probably damaging 1.00
R3944:Vps8 UTSW 16 21,288,873 (GRCm39) missense probably damaging 1.00
R4043:Vps8 UTSW 16 21,345,146 (GRCm39) missense probably damaging 1.00
R4302:Vps8 UTSW 16 21,314,664 (GRCm39) missense probably damaging 1.00
R4398:Vps8 UTSW 16 21,323,216 (GRCm39) missense probably damaging 1.00
R4477:Vps8 UTSW 16 21,363,986 (GRCm39) intron probably benign
R4478:Vps8 UTSW 16 21,363,986 (GRCm39) intron probably benign
R4479:Vps8 UTSW 16 21,363,986 (GRCm39) intron probably benign
R4480:Vps8 UTSW 16 21,363,986 (GRCm39) intron probably benign
R4571:Vps8 UTSW 16 21,254,525 (GRCm39) missense probably damaging 1.00
R4653:Vps8 UTSW 16 21,318,960 (GRCm39) missense probably damaging 1.00
R4664:Vps8 UTSW 16 21,262,938 (GRCm39) splice site probably null
R4713:Vps8 UTSW 16 21,261,189 (GRCm39) missense probably damaging 1.00
R4726:Vps8 UTSW 16 21,267,154 (GRCm39) splice site probably null
R4959:Vps8 UTSW 16 21,278,536 (GRCm39) missense probably damaging 1.00
R4973:Vps8 UTSW 16 21,278,536 (GRCm39) missense probably damaging 1.00
R4975:Vps8 UTSW 16 21,285,219 (GRCm39) missense probably damaging 1.00
R4992:Vps8 UTSW 16 21,280,158 (GRCm39) missense possibly damaging 0.52
R5144:Vps8 UTSW 16 21,378,103 (GRCm39) missense probably damaging 1.00
R5168:Vps8 UTSW 16 21,351,849 (GRCm39) missense probably benign 0.05
R5168:Vps8 UTSW 16 21,276,195 (GRCm39) missense probably damaging 0.99
R5222:Vps8 UTSW 16 21,400,298 (GRCm39) nonsense probably null
R5231:Vps8 UTSW 16 21,395,475 (GRCm39) missense probably damaging 1.00
R5876:Vps8 UTSW 16 21,280,189 (GRCm39) critical splice donor site probably null
R5963:Vps8 UTSW 16 21,288,871 (GRCm39) missense possibly damaging 0.48
R6010:Vps8 UTSW 16 21,363,955 (GRCm39) intron probably benign
R6023:Vps8 UTSW 16 21,279,988 (GRCm39) missense probably benign 0.32
R6173:Vps8 UTSW 16 21,314,682 (GRCm39) splice site probably null
R6185:Vps8 UTSW 16 21,288,891 (GRCm39) missense probably damaging 0.98
R6264:Vps8 UTSW 16 21,378,099 (GRCm39) nonsense probably null
R6409:Vps8 UTSW 16 21,297,189 (GRCm39) missense probably benign 0.29
R6522:Vps8 UTSW 16 21,261,129 (GRCm39) missense probably damaging 0.99
R6528:Vps8 UTSW 16 21,372,875 (GRCm39) nonsense probably null
R6784:Vps8 UTSW 16 21,381,957 (GRCm39) missense probably benign 0.01
R7040:Vps8 UTSW 16 21,393,772 (GRCm39) missense probably damaging 1.00
R7072:Vps8 UTSW 16 21,400,329 (GRCm39) missense probably benign
R7103:Vps8 UTSW 16 21,345,191 (GRCm39) missense probably damaging 1.00
R7149:Vps8 UTSW 16 21,278,526 (GRCm39) missense probably damaging 1.00
R7195:Vps8 UTSW 16 21,275,032 (GRCm39) missense probably damaging 1.00
R7206:Vps8 UTSW 16 21,276,171 (GRCm39) missense probably damaging 1.00
R7403:Vps8 UTSW 16 21,253,722 (GRCm39) missense possibly damaging 0.78
R7782:Vps8 UTSW 16 21,330,308 (GRCm39) missense possibly damaging 0.89
R7806:Vps8 UTSW 16 21,278,501 (GRCm39) missense probably damaging 1.00
R7846:Vps8 UTSW 16 21,351,070 (GRCm39) missense probably benign 0.01
R7943:Vps8 UTSW 16 21,296,622 (GRCm39) missense possibly damaging 0.66
R8075:Vps8 UTSW 16 21,340,644 (GRCm39) missense probably damaging 0.99
R8190:Vps8 UTSW 16 21,393,780 (GRCm39) missense possibly damaging 0.73
R8307:Vps8 UTSW 16 21,314,652 (GRCm39) missense probably benign 0.02
R8483:Vps8 UTSW 16 21,393,763 (GRCm39) missense probably damaging 0.98
R9064:Vps8 UTSW 16 21,288,979 (GRCm39) missense probably damaging 1.00
R9367:Vps8 UTSW 16 21,340,668 (GRCm39) missense possibly damaging 0.45
R9404:Vps8 UTSW 16 21,426,927 (GRCm39) missense probably benign 0.12
R9544:Vps8 UTSW 16 21,336,893 (GRCm39) missense probably benign 0.00
R9570:Vps8 UTSW 16 21,462,953 (GRCm39) missense probably benign 0.10
R9634:Vps8 UTSW 16 21,372,893 (GRCm39) missense probably damaging 1.00
R9702:Vps8 UTSW 16 21,462,883 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGGCTTGAGCATCTCAGTG -3'
(R):5'- TGTACTACTGCCTGGCTACC -3'

Sequencing Primer
(F):5'- GAGCATCTCAGTGTCCGAATC -3'
(R):5'- CACGGCCCCGAGAGTTAG -3'
Posted On 2021-04-30