Incidental Mutation 'R8814:Kng2'
ID 672634
Institutional Source Beutler Lab
Gene Symbol Kng2
Ensembl Gene ENSMUSG00000060459
Gene Name kininogen 2
Synonyms Kininogen-II
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 22804602-22847851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 22822761 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 197 (I197N)
Ref Sequence ENSEMBL: ENSMUSP00000097623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039338] [ENSMUST00000100046] [ENSMUST00000115349] [ENSMUST00000160243] [ENSMUST00000232459]
AlphaFold Q6S9I3
Predicted Effect probably benign
Transcript: ENSMUST00000039338
AA Change: I197N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000046867
Gene: ENSMUSG00000060459
AA Change: I197N

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100046
AA Change: I197N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097623
Gene: ENSMUSG00000060459
AA Change: I197N

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 478 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115349
AA Change: I197N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000111006
Gene: ENSMUSG00000060459
AA Change: I197N

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160243
SMART Domains Protein: ENSMUSP00000124161
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
Blast:CY 140 171 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231872
Predicted Effect probably benign
Transcript: ENSMUST00000232459
AA Change: I133N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Kng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Kng2 APN 16 22,847,580 (GRCm39) missense probably damaging 1.00
IGL01319:Kng2 APN 16 22,847,584 (GRCm39) missense probably damaging 0.99
IGL01469:Kng2 APN 16 22,818,577 (GRCm39) missense probably damaging 1.00
IGL01681:Kng2 APN 16 22,815,767 (GRCm39) splice site probably benign
IGL01830:Kng2 APN 16 22,806,801 (GRCm39) missense probably damaging 0.97
IGL01903:Kng2 APN 16 22,806,540 (GRCm39) missense possibly damaging 0.80
IGL02146:Kng2 APN 16 22,806,582 (GRCm39) missense probably damaging 0.97
IGL02305:Kng2 APN 16 22,819,374 (GRCm39) unclassified probably benign
IGL02429:Kng2 APN 16 22,830,829 (GRCm39) missense probably damaging 0.99
FR4548:Kng2 UTSW 16 22,819,302 (GRCm39) nonsense probably null
R0020:Kng2 UTSW 16 22,816,046 (GRCm39) missense probably benign 0.02
R0047:Kng2 UTSW 16 22,806,313 (GRCm39) missense possibly damaging 0.83
R0245:Kng2 UTSW 16 22,830,931 (GRCm39) splice site probably benign
R0610:Kng2 UTSW 16 22,819,344 (GRCm39) missense possibly damaging 0.96
R0646:Kng2 UTSW 16 22,806,486 (GRCm39) missense probably benign 0.10
R0666:Kng2 UTSW 16 22,815,872 (GRCm39) splice site probably benign
R1552:Kng2 UTSW 16 22,806,270 (GRCm39) missense probably damaging 1.00
R1765:Kng2 UTSW 16 22,806,993 (GRCm39) critical splice donor site probably null
R1833:Kng2 UTSW 16 22,830,802 (GRCm39) missense possibly damaging 0.95
R1997:Kng2 UTSW 16 22,843,626 (GRCm39) missense possibly damaging 0.84
R2025:Kng2 UTSW 16 22,819,325 (GRCm39) missense probably benign 0.15
R2056:Kng2 UTSW 16 22,806,703 (GRCm39) intron probably benign
R2137:Kng2 UTSW 16 22,816,076 (GRCm39) intron probably benign
R2517:Kng2 UTSW 16 22,807,065 (GRCm39) missense probably benign 0.24
R3438:Kng2 UTSW 16 22,830,821 (GRCm39) missense probably benign 0.23
R3439:Kng2 UTSW 16 22,830,821 (GRCm39) missense probably benign 0.23
R3551:Kng2 UTSW 16 22,830,745 (GRCm39) critical splice donor site probably null
R4389:Kng2 UTSW 16 22,843,618 (GRCm39) missense possibly damaging 0.91
R4538:Kng2 UTSW 16 22,806,813 (GRCm39) missense probably benign 0.00
R4684:Kng2 UTSW 16 22,806,391 (GRCm39) missense possibly damaging 0.93
R4978:Kng2 UTSW 16 22,806,666 (GRCm39) missense probably damaging 1.00
R5658:Kng2 UTSW 16 22,815,770 (GRCm39) splice site probably null
R6074:Kng2 UTSW 16 22,819,346 (GRCm39) missense probably benign 0.03
R6216:Kng2 UTSW 16 22,806,343 (GRCm39) missense probably damaging 1.00
R6271:Kng2 UTSW 16 22,822,698 (GRCm39) missense probably benign 0.33
R6459:Kng2 UTSW 16 22,830,865 (GRCm39) missense probably damaging 1.00
R7124:Kng2 UTSW 16 22,830,805 (GRCm39) missense probably damaging 1.00
R7310:Kng2 UTSW 16 22,806,522 (GRCm39) missense probably benign 0.00
R7532:Kng2 UTSW 16 22,845,794 (GRCm39) splice site probably null
R7667:Kng2 UTSW 16 22,806,982 (GRCm39) missense probably damaging 0.99
R7787:Kng2 UTSW 16 22,818,598 (GRCm39) missense probably damaging 1.00
R8092:Kng2 UTSW 16 22,806,672 (GRCm39) missense probably benign 0.00
R8165:Kng2 UTSW 16 22,806,246 (GRCm39) missense unknown
R9019:Kng2 UTSW 16 22,847,546 (GRCm39) missense probably damaging 0.99
R9048:Kng2 UTSW 16 22,806,522 (GRCm39) missense probably benign 0.00
R9531:Kng2 UTSW 16 22,830,907 (GRCm39) missense possibly damaging 0.81
R9708:Kng2 UTSW 16 22,815,801 (GRCm39) missense probably damaging 0.99
R9764:Kng2 UTSW 16 22,822,737 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCCAGCAACTTAGGTCC -3'
(R):5'- GATGCTATTGCCCAGTAATAATGAAGG -3'

Sequencing Primer
(F):5'- CAGCAACTTAGGTCCTAAGATTCTGG -3'
(R):5'- GCCCAGTAATAATGAAGGTTTGTAC -3'
Posted On 2021-04-30