Incidental Mutation 'R8814:Cyp1b1'
ID 672635
Institutional Source Beutler Lab
Gene Symbol Cyp1b1
Ensembl Gene ENSMUSG00000024087
Gene Name cytochrome P450, family 1, subfamily b, polypeptide 1
Synonyms
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.372) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 80014369-80022490 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80020788 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 318 (E318G)
Ref Sequence ENSEMBL: ENSMUSP00000024894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024894]
AlphaFold Q64429
Predicted Effect probably benign
Transcript: ENSMUST00000024894
AA Change: E318G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000024894
Gene: ENSMUSG00000024087
AA Change: E318G

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:p450 51 520 1.3e-100 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The enzyme encoded by this gene localizes to the endoplasmic reticulum and metabolizes procarcinogens such as polycyclic aromatic hydrocarbons and 17beta-estradiol. Mutations in this gene have been associated with primary congenital glaucoma; therefore it is thought that the enzyme also metabolizes a signaling molecule involved in eye development, possibly a steroid. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are protected from the acute bone marrow cytotoxic and preleukemic effects of DMBA, show a decreased incidence of DMBA-induced lymphomas, and display background-sensitive ocular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Cyp1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0387:Cyp1b1 UTSW 17 80,021,203 (GRCm39) missense probably benign
R0400:Cyp1b1 UTSW 17 80,021,016 (GRCm39) missense probably damaging 1.00
R0456:Cyp1b1 UTSW 17 80,017,704 (GRCm39) missense probably benign 0.02
R0681:Cyp1b1 UTSW 17 80,021,275 (GRCm39) missense probably damaging 0.97
R2851:Cyp1b1 UTSW 17 80,017,649 (GRCm39) missense probably benign 0.00
R2897:Cyp1b1 UTSW 17 80,021,160 (GRCm39) missense probably benign 0.00
R4706:Cyp1b1 UTSW 17 80,020,771 (GRCm39) missense possibly damaging 0.86
R5070:Cyp1b1 UTSW 17 80,018,040 (GRCm39) missense probably benign
R6104:Cyp1b1 UTSW 17 80,017,634 (GRCm39) missense probably damaging 1.00
R6195:Cyp1b1 UTSW 17 80,021,695 (GRCm39) missense probably damaging 1.00
R6233:Cyp1b1 UTSW 17 80,021,695 (GRCm39) missense probably damaging 1.00
R7440:Cyp1b1 UTSW 17 80,020,986 (GRCm39) missense probably damaging 0.99
R7770:Cyp1b1 UTSW 17 80,020,728 (GRCm39) missense probably damaging 1.00
R7894:Cyp1b1 UTSW 17 80,021,644 (GRCm39) missense possibly damaging 0.81
R7982:Cyp1b1 UTSW 17 80,017,919 (GRCm39) missense probably damaging 1.00
R8241:Cyp1b1 UTSW 17 80,021,223 (GRCm39) missense probably damaging 1.00
R8528:Cyp1b1 UTSW 17 80,017,993 (GRCm39) missense probably damaging 1.00
R9743:Cyp1b1 UTSW 17 80,017,808 (GRCm39) missense probably benign 0.33
X0067:Cyp1b1 UTSW 17 80,018,120 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- ACCCGGCCTTATCTTACCTGAG -3'
(R):5'- CAAGTTCGAGCAGCTCAACC -3'

Sequencing Primer
(F):5'- AGATCTCAGTTTCGAGGAATTGG -3'
(R):5'- CGCAACTTCAGCAACTTCG -3'
Posted On 2021-04-30