Incidental Mutation 'R8814:Nrxn1'
ID 672636
Institutional Source Beutler Lab
Gene Symbol Nrxn1
Ensembl Gene ENSMUSG00000024109
Gene Name neurexin I
Synonyms neurexin I beta, alpha-latrotoxin receptor (calcium-dependent), A230068P09Rik, neurexin I alpha, neurexin I alpha, neurexin I beta, 1700062G21Rik, 9330127H16Rik, neurexin I alpha, neurexin I beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 90033631-91093071 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90630101 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 643 (C643S)
Ref Sequence ENSEMBL: ENSMUSP00000125407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054059] [ENSMUST00000072671] [ENSMUST00000160800] [ENSMUST00000160844] [ENSMUST00000161402] [ENSMUST00000174331] [ENSMUST00000177342]
AlphaFold Q9CS84
Predicted Effect probably damaging
Transcript: ENSMUST00000054059
AA Change: C635S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057294
Gene: ENSMUSG00000024109
AA Change: C635S

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
4.1m 1444 1462 1.19e-6 SMART
low complexity region 1481 1493 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072671
AA Change: C635S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072458
Gene: ENSMUSG00000024109
AA Change: C635S

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1423 1438 N/A INTRINSIC
4.1m 1441 1459 1.19e-6 SMART
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160800
AA Change: C631S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124561
Gene: ENSMUSG00000024109
AA Change: C631S

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 300 434 2.3e-36 SMART
LamG 488 640 2.74e-43 SMART
EGF 667 701 1.58e-3 SMART
LamG 726 865 7.27e-25 SMART
LamG 913 1049 8.46e-35 SMART
EGF 1074 1108 1.87e1 SMART
LamG 1136 1293 7.74e-20 SMART
low complexity region 1320 1351 N/A INTRINSIC
low complexity region 1422 1437 N/A INTRINSIC
4.1m 1440 1458 1.19e-6 SMART
low complexity region 1477 1489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160844
AA Change: C643S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125407
Gene: ENSMUSG00000024109
AA Change: C643S

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1305 7.74e-20 SMART
low complexity region 1332 1363 N/A INTRINSIC
low complexity region 1434 1449 N/A INTRINSIC
4.1m 1452 1470 1.19e-6 SMART
low complexity region 1489 1501 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161402
AA Change: C650S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124116
Gene: ENSMUSG00000024109
AA Change: C650S

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 453 3.46e-31 SMART
LamG 507 659 2.74e-43 SMART
EGF 686 720 1.58e-3 SMART
LamG 745 884 7.27e-25 SMART
LamG 932 1068 8.46e-35 SMART
EGF 1093 1127 1.87e1 SMART
LamG 1155 1312 7.74e-20 SMART
low complexity region 1339 1370 N/A INTRINSIC
low complexity region 1441 1456 N/A INTRINSIC
4.1m 1459 1477 1.19e-6 SMART
low complexity region 1496 1508 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174331
AA Change: C643S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133491
Gene: ENSMUSG00000024109
AA Change: C643S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1275 3.29e-23 SMART
low complexity region 1302 1333 N/A INTRINSIC
low complexity region 1404 1419 N/A INTRINSIC
4.1m 1422 1440 1.19e-6 SMART
low complexity region 1459 1471 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177342
AA Change: C42S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135301
Gene: ENSMUSG00000024109
AA Change: C42S

DomainStartEndE-ValueType
Pfam:Laminin_G_2 1 51 4.8e-5 PFAM
EGF 78 112 7.6e-6 SMART
LamG 137 267 5.3e-29 SMART
SCOP:d1dyka1 273 327 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197224
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a single-pass type I membrane protein that belongs to the neurexin family. Neurexins are synaptic transmembrane receptors that bind endogenous ligands that include neuroligins, dystroglycan, and neurexophilins. Neurexin complexes are required for efficient neurotransmission and are involved in synaptogenesis. In vertebrates, alternate promoter usage results in multiple isoform classes, of which the alpha and beta classes are the best characterized. In humans, allelic variants in this gene are associated with Pitt-Hopkins-like syndrome-2, while deletions have been associated with autism and schizophrenia. Mouse knockouts display decreased spontaneous and evoked vesicle release resulting in impaired synaptic transmission. In addition, knockout mice show altered social approach, reduced social investigation, reduced locomotor activity, and in males, increased aggression. Alternative splicing and promoter usage result in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Ca(2+)-dependent binding of alpha-latrotoxin to brain membranes. Isolated synaptosomes display only a small reduction in alpha-latrotoxin -triggered glutamate release in the absence of Ca(2+) but show a major decrease in the presence of Ca(2+). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
Brd7 A G 8: 88,345,154 V361A probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cacna2d3 T A 14: 29,097,815 Y532F probably damaging Het
Cep85l A T 10: 53,348,969 Y175N probably benign Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Crispld2 A G 8: 120,015,345 H144R possibly damaging Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hace1 A G 10: 45,652,701 Y346C probably damaging Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Mterf1b T C 5: 4,197,456 S366P probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr485 T A 7: 108,159,065 K269N probably benign Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Scarb1 A T 5: 125,294,092 D305E probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slfn8 A G 11: 83,016,679 V346A possibly damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Soga1 C T 2: 157,030,531 W965* probably null Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Uaca A G 9: 60,866,398 N396D possibly damaging Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Vps8 T C 16: 21,576,650 L1230P probably damaging Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Nrxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Nrxn1 APN 17 90059474 critical splice donor site probably null
IGL01644:Nrxn1 APN 17 90620873 missense possibly damaging 0.94
IGL01820:Nrxn1 APN 17 90643103 missense probably damaging 0.98
IGL01902:Nrxn1 APN 17 91088491 splice site probably null
IGL02079:Nrxn1 APN 17 90643083 missense probably damaging 0.99
IGL02089:Nrxn1 APN 17 91088401 missense probably benign 0.01
IGL02133:Nrxn1 APN 17 90643243 missense probably damaging 1.00
IGL02179:Nrxn1 APN 17 90630083 missense probably damaging 0.99
IGL02199:Nrxn1 APN 17 90037258 missense probably damaging 1.00
IGL02262:Nrxn1 APN 17 90704208 missense probably damaging 1.00
IGL02941:Nrxn1 APN 17 90208383 missense probably damaging 1.00
PIT4449001:Nrxn1 UTSW 17 90597579 missense probably damaging 1.00
PIT4791001:Nrxn1 UTSW 17 90455503 intron probably benign
R0123:Nrxn1 UTSW 17 90995487 splice site probably null
R0212:Nrxn1 UTSW 17 90362758 unclassified probably benign
R0277:Nrxn1 UTSW 17 90700742 critical splice donor site probably null
R0323:Nrxn1 UTSW 17 90700742 critical splice donor site probably null
R0384:Nrxn1 UTSW 17 90208347 missense probably damaging 1.00
R0395:Nrxn1 UTSW 17 91088314 missense possibly damaging 0.90
R0606:Nrxn1 UTSW 17 90565373 missense probably damaging 1.00
R0616:Nrxn1 UTSW 17 90362857 missense probably damaging 1.00
R0624:Nrxn1 UTSW 17 91088689 missense unknown
R0633:Nrxn1 UTSW 17 90704181 missense probably damaging 1.00
R0927:Nrxn1 UTSW 17 90037330 missense probably damaging 1.00
R1035:Nrxn1 UTSW 17 90163874 missense probably damaging 0.96
R1221:Nrxn1 UTSW 17 90643294 missense probably damaging 0.97
R1403:Nrxn1 UTSW 17 90643053 missense probably benign 0.11
R1403:Nrxn1 UTSW 17 90643053 missense probably benign 0.11
R1691:Nrxn1 UTSW 17 90162289 missense probably damaging 0.98
R1703:Nrxn1 UTSW 17 90208417 missense probably damaging 1.00
R1709:Nrxn1 UTSW 17 90037187 missense probably damaging 1.00
R1721:Nrxn1 UTSW 17 90162404 missense probably damaging 1.00
R1792:Nrxn1 UTSW 17 90588824 missense probably damaging 0.96
R1980:Nrxn1 UTSW 17 91088318 missense probably benign 0.01
R2116:Nrxn1 UTSW 17 90704277 missense probably damaging 1.00
R2117:Nrxn1 UTSW 17 90704277 missense probably damaging 1.00
R2162:Nrxn1 UTSW 17 90162431 missense probably damaging 1.00
R3119:Nrxn1 UTSW 17 90597519 nonsense probably null
R3409:Nrxn1 UTSW 17 90208367 missense probably damaging 1.00
R3683:Nrxn1 UTSW 17 90623452 missense probably damaging 1.00
R3885:Nrxn1 UTSW 17 90623471 missense probably damaging 1.00
R3939:Nrxn1 UTSW 17 90208421 missense probably damaging 1.00
R4475:Nrxn1 UTSW 17 90701982 missense probably damaging 0.98
R4640:Nrxn1 UTSW 17 90560768 missense probably damaging 1.00
R4678:Nrxn1 UTSW 17 90623422 missense probably damaging 1.00
R4690:Nrxn1 UTSW 17 90037081 missense probably damaging 1.00
R4790:Nrxn1 UTSW 17 90455049 missense possibly damaging 0.86
R4877:Nrxn1 UTSW 17 91088177 missense probably benign 0.33
R4989:Nrxn1 UTSW 17 90620846 intron probably benign
R5204:Nrxn1 UTSW 17 90162364 missense probably damaging 1.00
R5205:Nrxn1 UTSW 17 90163874 missense probably damaging 0.96
R5239:Nrxn1 UTSW 17 90704109 missense probably damaging 1.00
R5250:Nrxn1 UTSW 17 90535441 intron probably benign
R5473:Nrxn1 UTSW 17 90590092 missense probably damaging 1.00
R5629:Nrxn1 UTSW 17 90590032 missense possibly damaging 0.75
R5743:Nrxn1 UTSW 17 90643224 missense probably damaging 1.00
R5910:Nrxn1 UTSW 17 90704318 nonsense probably null
R5961:Nrxn1 UTSW 17 90454943 missense probably damaging 0.99
R5979:Nrxn1 UTSW 17 91088203 missense possibly damaging 0.54
R5992:Nrxn1 UTSW 17 90623507 missense probably benign 0.01
R6024:Nrxn1 UTSW 17 90590098 missense possibly damaging 0.88
R6031:Nrxn1 UTSW 17 90588790 missense probably damaging 1.00
R6031:Nrxn1 UTSW 17 90588790 missense probably damaging 1.00
R6185:Nrxn1 UTSW 17 90037136 missense probably damaging 1.00
R6220:Nrxn1 UTSW 17 91088476 missense probably benign 0.14
R6306:Nrxn1 UTSW 17 90565446 missense possibly damaging 0.55
R6621:Nrxn1 UTSW 17 90162182 missense probably damaging 1.00
R6669:Nrxn1 UTSW 17 90059563 missense probably damaging 0.98
R6770:Nrxn1 UTSW 17 90037179 missense probably damaging 1.00
R6798:Nrxn1 UTSW 17 90629950 missense probably damaging 1.00
R6923:Nrxn1 UTSW 17 91088233 missense probably benign 0.06
R7140:Nrxn1 UTSW 17 91088764 start gained probably benign
R7374:Nrxn1 UTSW 17 90588669 critical splice donor site probably null
R7564:Nrxn1 UTSW 17 90362906 missense possibly damaging 0.64
R7570:Nrxn1 UTSW 17 90162379 missense probably benign 0.35
R7800:Nrxn1 UTSW 17 91089207 unclassified probably benign
R7828:Nrxn1 UTSW 17 90059551 missense probably damaging 0.99
R7974:Nrxn1 UTSW 17 90700779 missense probably damaging 1.00
R8001:Nrxn1 UTSW 17 91088536 missense possibly damaging 0.49
R8189:Nrxn1 UTSW 17 90704209 missense probably damaging 0.96
R8258:Nrxn1 UTSW 17 90163821 missense probably damaging 0.99
R8259:Nrxn1 UTSW 17 90163821 missense probably damaging 0.99
R8298:Nrxn1 UTSW 17 90704169 missense probably damaging 1.00
R8801:Nrxn1 UTSW 17 90701965 critical splice donor site probably benign
R8873:Nrxn1 UTSW 17 90565393 nonsense probably null
R8954:Nrxn1 UTSW 17 90590187 missense probably damaging 1.00
R9086:Nrxn1 UTSW 17 90162364 missense probably damaging 1.00
R9110:Nrxn1 UTSW 17 90561805 nonsense probably null
R9498:Nrxn1 UTSW 17 90589969 missense probably damaging 1.00
R9499:Nrxn1 UTSW 17 90630022 missense probably damaging 1.00
R9552:Nrxn1 UTSW 17 90630022 missense probably damaging 1.00
R9780:Nrxn1 UTSW 17 90623614 missense possibly damaging 0.54
RF005:Nrxn1 UTSW 17 90362876 missense probably damaging 1.00
RF024:Nrxn1 UTSW 17 90362876 missense probably damaging 1.00
X0021:Nrxn1 UTSW 17 90590212 missense probably damaging 1.00
X0063:Nrxn1 UTSW 17 90362831 missense possibly damaging 0.54
Z1088:Nrxn1 UTSW 17 90059505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCAATCGCAGACGTATC -3'
(R):5'- AGAGCTCATTGCATGCCTAAAC -3'

Sequencing Primer
(F):5'- AGACGTATCTGTTCCAGCCATC -3'
(R):5'- GCTCATTGCATGCCTAAACAACTTC -3'
Posted On 2021-04-30