Incidental Mutation 'R8814:Or1s2'
ID 672637
Institutional Source Beutler Lab
Gene Symbol Or1s2
Ensembl Gene ENSMUSG00000048356
Gene Name olfactory receptor family 1 subfamily S member 1
Synonyms GA_x6K02T2RE5P-4112771-4113718, MOR127-1, Olfr1496
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 13757912-13758978 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13758897 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 305 (I305N)
Ref Sequence ENSEMBL: ENSMUSP00000146523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057390] [ENSMUST00000209137] [ENSMUST00000219412]
AlphaFold B9EHG2
Predicted Effect possibly damaging
Transcript: ENSMUST00000057390
AA Change: I305N

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054924
Gene: ENSMUSG00000048356
AA Change: I305N

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.7e-57 PFAM
Pfam:7TM_GPCR_Srsx 37 307 1.4e-8 PFAM
Pfam:7tm_1 43 292 3.6e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209137
AA Change: I305N

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219412
AA Change: I307N

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Or1s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Or1s2 APN 19 13,758,937 (GRCm39) utr 3 prime probably benign
IGL01577:Or1s2 APN 19 13,758,162 (GRCm39) missense probably damaging 1.00
IGL02080:Or1s2 APN 19 13,758,846 (GRCm39) missense probably damaging 1.00
IGL03111:Or1s2 APN 19 13,758,343 (GRCm39) nonsense probably null
R0829:Or1s2 UTSW 19 13,758,556 (GRCm39) missense probably damaging 0.99
R3945:Or1s2 UTSW 19 13,758,786 (GRCm39) missense probably benign 0.00
R4395:Or1s2 UTSW 19 13,758,275 (GRCm39) missense probably benign 0.01
R4791:Or1s2 UTSW 19 13,758,706 (GRCm39) nonsense probably null
R7299:Or1s2 UTSW 19 13,758,688 (GRCm39) nonsense probably null
R7762:Or1s2 UTSW 19 13,758,650 (GRCm39) missense probably damaging 0.99
R7861:Or1s2 UTSW 19 13,758,810 (GRCm39) missense possibly damaging 0.91
R8496:Or1s2 UTSW 19 13,758,384 (GRCm39) missense probably benign
R8838:Or1s2 UTSW 19 13,758,381 (GRCm39) missense probably benign 0.31
R9091:Or1s2 UTSW 19 13,758,333 (GRCm39) missense probably benign 0.01
R9270:Or1s2 UTSW 19 13,758,333 (GRCm39) missense probably benign 0.01
R9555:Or1s2 UTSW 19 13,758,360 (GRCm39) missense probably damaging 1.00
R9675:Or1s2 UTSW 19 13,758,639 (GRCm39) missense possibly damaging 0.70
Z1177:Or1s2 UTSW 19 13,758,888 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTGAGAATTTCATCCACGGAAG -3'
(R):5'- GTGTAAAAGCACTTATCACTCAGAG -3'

Sequencing Primer
(F):5'- GAAAGTGGAAAGCCTTCTCTACCTG -3'
(R):5'- GCACTTATCACTCAGAGTTGGAAG -3'
Posted On 2021-04-30