Incidental Mutation 'T0970:Prss38'
ID67265
Institutional Source Beutler Lab
Gene Symbol Prss38
Ensembl Gene ENSMUSG00000049291
Gene Nameprotease, serine 38
SynonymsGm249, LOC216797
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #T0970 (G3) of strain 713
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59372669-59375657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59373148 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 246 (V246A)
Ref Sequence ENSEMBL: ENSMUSP00000052010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061481]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061481
AA Change: V246A

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052010
Gene: ENSMUSG00000049291
AA Change: V246A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 55 284 7.08e-75 SMART
low complexity region 288 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133698
Meta Mutation Damage Score 0.2990 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (25/25)
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A T 10: 88,981,190 L591* probably null Het
Aqp4 A G 18: 15,399,883 L51P probably damaging Het
Cemip A T 7: 83,983,146 C403S probably damaging Het
Cfap74 G T 4: 155,463,117 probably null Het
Glis3 G A 19: 28,530,932 R551W probably damaging Het
Gm11232 T A 4: 71,756,503 Y254F possibly damaging Het
Gm11492 A T 11: 87,567,732 T311S probably damaging Het
Map3k14 G T 11: 103,224,298 C837* probably null Het
Mrc2 A C 11: 105,347,627 E1200A probably benign Het
Nfix T C 8: 84,726,483 N314S possibly damaging Het
Nphp4 T C 4: 152,556,379 S1068P probably damaging Het
Nup98 A C 7: 102,186,752 probably benign Het
Olfr1340 A G 4: 118,726,267 R7G probably benign Het
Pcdhac2 T C 18: 37,145,335 V456A possibly damaging Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Rnf26 C G 9: 44,112,072 R172P probably damaging Het
Serinc3 TATCATC TATC 2: 163,627,915 probably benign Het
Spire1 C A 18: 67,501,063 probably null Het
Tex2 T A 11: 106,546,946 I633F unknown Het
Tle2 A G 10: 81,580,285 D108G possibly damaging Het
Txnrd2 T C 16: 18,441,773 V185A probably damaging Het
Unc45b C A 11: 82,922,888 H374N probably benign Het
Wtap T C 17: 12,969,390 probably benign Het
Other mutations in Prss38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03075:Prss38 APN 11 59373055 missense probably damaging 1.00
LCD18:Prss38 UTSW 11 59375641 utr 5 prime probably benign
R0001:Prss38 UTSW 11 59373180 splice site probably benign
R0097:Prss38 UTSW 11 59375608 missense possibly damaging 0.86
R0097:Prss38 UTSW 11 59375608 missense possibly damaging 0.86
R0540:Prss38 UTSW 11 59375543 missense possibly damaging 0.50
R0607:Prss38 UTSW 11 59375543 missense possibly damaging 0.50
R1966:Prss38 UTSW 11 59373484 missense probably damaging 1.00
R4394:Prss38 UTSW 11 59373028 missense probably damaging 1.00
R4397:Prss38 UTSW 11 59373028 missense probably damaging 1.00
R4529:Prss38 UTSW 11 59373499 missense probably damaging 1.00
R4738:Prss38 UTSW 11 59372945 missense probably benign 0.00
R5061:Prss38 UTSW 11 59374370 missense probably damaging 0.98
R5219:Prss38 UTSW 11 59375483 splice site probably benign
R5306:Prss38 UTSW 11 59372995 missense probably benign 0.00
R6894:Prss38 UTSW 11 59373024 missense probably benign 0.19
R7286:Prss38 UTSW 11 59375558 missense probably benign 0.00
R7860:Prss38 UTSW 11 59375170 missense probably damaging 1.00
R7943:Prss38 UTSW 11 59375170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAGCAGGTGCCCCATTATG -3'
(R):5'- TGGAAGCCCAGTTGCCACTAATC -3'

Sequencing Primer
(F):5'- AGGTGCCCCATTATGGTCAC -3'
(R):5'- GGGCATACCTGGTCTAGTAGATCA -3'
Posted On2013-09-03