Incidental Mutation 'R8815:Pepd'
ID672662
Institutional Source Beutler Lab
Gene Symbol Pepd
Ensembl Gene ENSMUSG00000063931
Gene Namepeptidase D
SynonymsPep4, Pep-4, dal, peptidase D
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8815 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location34912379-35044708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34971691 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 220 (Y220C)
Ref Sequence ENSEMBL: ENSMUSP00000075683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075068]
Predicted Effect probably damaging
Transcript: ENSMUST00000075068
AA Change: Y220C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075683
Gene: ENSMUSG00000063931
AA Change: Y220C

DomainStartEndE-ValueType
AMP_N 18 155 2.71e-39 SMART
Pfam:Peptidase_M24 193 459 5.4e-61 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133634
Gene: ENSMUSG00000063931
AA Change: Y72C

DomainStartEndE-ValueType
Blast:AMP_N 2 35 3e-15 BLAST
PDB:2OKN|B 2 76 1e-43 PDB
SCOP:d1b6a_2 7 77 2e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants are smaller than normal siblings and, except on the flanks, an agouti coat appears nonagouti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,784 Q106H probably damaging Het
A430078G23Rik C A 8: 3,380,410 H94Q probably benign Het
Acad9 T C 3: 36,085,441 C397R probably damaging Het
Ankfn1 T G 11: 89,391,776 R348S probably damaging Het
Ankrd61 A G 5: 143,894,518 C28R probably benign Het
Ano5 C T 7: 51,544,800 R94* probably null Het
Apela A T 8: 65,036,938 F10I unknown Het
Arhgap31 T C 16: 38,609,428 S362G probably benign Het
Astn2 A T 4: 65,912,597 L585Q possibly damaging Het
Atf3 G T 1: 191,177,367 A35D probably benign Het
Atp10b A T 11: 43,203,151 R507S possibly damaging Het
Brip1 A C 11: 86,189,772 V156G probably benign Het
Ccdc27 T A 4: 154,026,748 M636L probably benign Het
Ceacam5 T A 7: 17,759,360 N769K possibly damaging Het
Cklf C T 8: 104,250,928 probably benign Het
Cpeb4 G A 11: 31,920,546 V474M probably damaging Het
Dip2c T A 13: 9,623,798 C1091* probably null Het
Eef1akmt4 T A 16: 20,618,538 I210N possibly damaging Het
Fbxo38 A T 18: 62,533,516 H195Q probably damaging Het
Fbxw14 G A 9: 109,276,237 R287* probably null Het
Fes A G 7: 80,383,871 S211P possibly damaging Het
Fry G T 5: 150,394,138 R861L possibly damaging Het
Gm14226 G A 2: 155,024,618 W165* probably null Het
Gm21671 A G 5: 25,953,193 S54P probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gprc6a A G 10: 51,620,983 V488A probably benign Het
Helb A T 10: 120,112,787 C26S possibly damaging Het
Icam1 A T 9: 21,026,566 I300F probably benign Het
Ip6k1 A G 9: 108,041,012 N181S probably benign Het
Itga2b C A 11: 102,460,861 R546L possibly damaging Het
Kif27 A T 13: 58,329,004 Y611N probably damaging Het
Lpcat2 A G 8: 92,914,351 I475V possibly damaging Het
Lrit2 A G 14: 37,072,530 K517R probably benign Het
Lrp1b A T 2: 40,665,159 I4085N Het
Lrrc32 T A 7: 98,499,035 S341T probably damaging Het
Lrrn2 T A 1: 132,939,093 I632K possibly damaging Het
Mettl22 A G 16: 8,482,314 Q194R probably benign Het
Mfhas1 T A 8: 35,590,240 V623E probably damaging Het
Mitd1 T C 1: 37,890,234 D26G probably damaging Het
Myo1a C T 10: 127,710,174 T222M probably benign Het
Naf1 A G 8: 66,864,681 K275R possibly damaging Het
Nf1 T C 11: 79,441,665 L765P probably damaging Het
Olfr198 T A 16: 59,201,901 H175L possibly damaging Het
Olfr360 G T 2: 37,068,417 M37I probably benign Het
Olfr68 A G 7: 103,777,856 L163P possibly damaging Het
Olfr823 T A 10: 130,111,939 I284F probably damaging Het
Pappa A G 4: 65,181,110 H622R probably benign Het
Pcdhb4 A T 18: 37,309,002 Y455F probably damaging Het
Pias3 T C 3: 96,700,065 I172T probably damaging Het
Polq T A 16: 37,033,531 H415Q probably damaging Het
Pp2d1 A T 17: 53,507,869 M609K probably benign Het
Prss22 T A 17: 23,996,688 T87S probably benign Het
Ptprf C A 4: 118,237,928 V254L possibly damaging Het
Ripply3 A G 16: 94,335,864 E128G possibly damaging Het
Rrm2 A C 12: 24,710,471 I185L possibly damaging Het
Sdc3 T A 4: 130,819,025 S232T probably benign Het
Slx4 G C 16: 3,985,594 P1119A probably benign Het
Smc5 C T 19: 23,244,058 R369Q probably damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Sptbn4 G A 7: 27,407,232 Q924* probably null Het
Srcap G C 7: 127,558,865 D2638H unknown Het
Srsf12 T C 4: 33,226,045 S103P possibly damaging Het
Tanc1 A G 2: 59,790,841 T335A possibly damaging Het
Them4 C T 3: 94,324,303 T149I probably damaging Het
Trpc7 T C 13: 56,822,499 Y424C possibly damaging Het
Ttn C T 2: 76,798,020 D14599N probably damaging Het
Ttn A T 2: 76,867,900 L186H Het
Usp17lc T C 7: 103,418,317 F273S probably benign Het
Vwa5b2 T C 16: 20,600,766 S620P probably damaging Het
Other mutations in Pepd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pepd APN 7 34924440 missense probably benign
IGL02102:Pepd APN 7 34945603 missense probably damaging 1.00
R1256:Pepd UTSW 7 34921492 missense possibly damaging 0.95
R1690:Pepd UTSW 7 35031357 missense probably damaging 1.00
R1734:Pepd UTSW 7 35031426 missense probably benign 0.07
R1911:Pepd UTSW 7 34934749 splice site probably benign
R1918:Pepd UTSW 7 34971676 missense probably benign 0.00
R2144:Pepd UTSW 7 34921418 missense probably benign 0.09
R4814:Pepd UTSW 7 34945597 missense probably damaging 0.96
R4924:Pepd UTSW 7 35020984 missense probably benign 0.24
R5490:Pepd UTSW 7 34942690 splice site probably null
R5669:Pepd UTSW 7 35040674 missense probably benign 0.38
R6240:Pepd UTSW 7 35021751 missense probably benign 0.00
R6300:Pepd UTSW 7 34969543 missense probably damaging 1.00
R6479:Pepd UTSW 7 35040722 missense probably benign 0.00
R6995:Pepd UTSW 7 35021719 missense probably damaging 1.00
R7303:Pepd UTSW 7 35021772 critical splice donor site probably null
R7587:Pepd UTSW 7 34969540 missense probably damaging 1.00
R8008:Pepd UTSW 7 35021701 missense probably benign 0.22
R8672:Pepd UTSW 7 34942682 missense probably damaging 0.97
X0021:Pepd UTSW 7 34954563 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGTGGTCCACGTAAACTC -3'
(R):5'- CAGAGGGACCATAATCTCTGCC -3'

Sequencing Primer
(F):5'- CTTGGAGCCATTGCAAAGGTC -3'
(R):5'- GGGACCATAATCTCTGCCTAGGATC -3'
Posted On2021-04-30