Incidental Mutation 'R8815:Gprc6a'
ID 672681
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 068650-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8815 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51497079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 488 (V488A)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: V488A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: V488A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: V313A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,421,943 (GRCm39) Q106H probably damaging Het
Acad9 T C 3: 36,139,590 (GRCm39) C397R probably damaging Het
Ankfn1 T G 11: 89,282,602 (GRCm39) R348S probably damaging Het
Ankrd61 A G 5: 143,831,336 (GRCm39) C28R probably benign Het
Ano5 C T 7: 51,194,548 (GRCm39) R94* probably null Het
Apela A T 8: 65,489,590 (GRCm39) F10I unknown Het
Arhgap31 T C 16: 38,429,790 (GRCm39) S362G probably benign Het
Arhgef18 C A 8: 3,430,410 (GRCm39) H94Q probably benign Het
Astn2 A T 4: 65,830,834 (GRCm39) L585Q possibly damaging Het
Atf3 G T 1: 190,909,564 (GRCm39) A35D probably benign Het
Atp10b A T 11: 43,093,978 (GRCm39) R507S possibly damaging Het
Brip1 A C 11: 86,080,598 (GRCm39) V156G probably benign Het
Ccdc27 T A 4: 154,111,205 (GRCm39) M636L probably benign Het
Ceacam5 T A 7: 17,493,285 (GRCm39) N769K possibly damaging Het
Cklf C T 8: 104,977,560 (GRCm39) probably benign Het
Cpeb4 G A 11: 31,870,546 (GRCm39) V474M probably damaging Het
Dip2c T A 13: 9,673,834 (GRCm39) C1091* probably null Het
Eef1akmt4 T A 16: 20,437,288 (GRCm39) I210N possibly damaging Het
Fbxo38 A T 18: 62,666,587 (GRCm39) H195Q probably damaging Het
Fbxw14 G A 9: 109,105,305 (GRCm39) R287* probably null Het
Fes A G 7: 80,033,619 (GRCm39) S211P possibly damaging Het
Fry G T 5: 150,317,603 (GRCm39) R861L possibly damaging Het
Galnt12 A G 4: 47,113,908 (GRCm39) probably benign Het
Gm14226 G A 2: 154,866,538 (GRCm39) W165* probably null Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 141,794,171 (GRCm39) probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Haus8 A T 8: 71,705,910 (GRCm39) probably benign Het
Helb A T 10: 119,948,692 (GRCm39) C26S possibly damaging Het
Icam1 A T 9: 20,937,862 (GRCm39) I300F probably benign Het
Ip6k1 A G 9: 107,918,211 (GRCm39) N181S probably benign Het
Itga2b C A 11: 102,351,687 (GRCm39) R546L possibly damaging Het
Kif27 A T 13: 58,476,818 (GRCm39) Y611N probably damaging Het
Lpcat2 A G 8: 93,640,979 (GRCm39) I475V possibly damaging Het
Lrit2 A G 14: 36,794,487 (GRCm39) K517R probably benign Het
Lrp1b A T 2: 40,555,171 (GRCm39) I4085N Het
Lrrc32 T A 7: 98,148,242 (GRCm39) S341T probably damaging Het
Lrrn2 T A 1: 132,866,831 (GRCm39) I632K possibly damaging Het
Mettl22 A G 16: 8,300,178 (GRCm39) Q194R probably benign Het
Mfhas1 T A 8: 36,057,394 (GRCm39) V623E probably damaging Het
Mitd1 T C 1: 37,929,315 (GRCm39) D26G probably damaging Het
Myo1a C T 10: 127,546,043 (GRCm39) T222M probably benign Het
Naf1 A G 8: 67,317,333 (GRCm39) K275R possibly damaging Het
Nf1 T C 11: 79,332,491 (GRCm39) L765P probably damaging Het
Or12k7 G T 2: 36,958,429 (GRCm39) M37I probably benign Het
Or52a5 A G 7: 103,427,063 (GRCm39) L163P possibly damaging Het
Or5ac16 T A 16: 59,022,264 (GRCm39) H175L possibly damaging Het
Or9r3 T A 10: 129,947,808 (GRCm39) I284F probably damaging Het
Pappa A G 4: 65,099,347 (GRCm39) H622R probably benign Het
Pcdhb4 A T 18: 37,442,055 (GRCm39) Y455F probably damaging Het
Pepd A G 7: 34,671,116 (GRCm39) Y220C probably damaging Het
Pias3 T C 3: 96,607,381 (GRCm39) I172T probably damaging Het
Polq T A 16: 36,853,893 (GRCm39) H415Q probably damaging Het
Pp2d1 A T 17: 53,814,897 (GRCm39) M609K probably benign Het
Ppm1m G A 9: 106,076,237 (GRCm39) probably benign Het
Prss22 T A 17: 24,215,662 (GRCm39) T87S probably benign Het
Ptprf C A 4: 118,095,125 (GRCm39) V254L possibly damaging Het
Ripply3 A G 16: 94,136,723 (GRCm39) E128G possibly damaging Het
Rrm2 A C 12: 24,760,470 (GRCm39) I185L possibly damaging Het
Sbsn T A 7: 30,454,227 (GRCm39) probably benign Het
Sdc3 T A 4: 130,546,336 (GRCm39) S232T probably benign Het
Slx4 G C 16: 3,803,458 (GRCm39) P1119A probably benign Het
Smc5 C T 19: 23,221,422 (GRCm39) R369Q probably damaging Het
Speer4a3 A G 5: 26,158,191 (GRCm39) S54P probably damaging Het
Spns1 G A 7: 125,971,593 (GRCm39) S319F possibly damaging Het
Sptbn4 G A 7: 27,106,657 (GRCm39) Q924* probably null Het
Srcap G C 7: 127,158,037 (GRCm39) D2638H unknown Het
Srsf12 T C 4: 33,226,045 (GRCm39) S103P possibly damaging Het
Tanc1 A G 2: 59,621,185 (GRCm39) T335A possibly damaging Het
Them4 C T 3: 94,231,610 (GRCm39) T149I probably damaging Het
Trpc7 T C 13: 56,970,312 (GRCm39) Y424C possibly damaging Het
Ttn C T 2: 76,628,364 (GRCm39) D14599N probably damaging Het
Ttn A T 2: 76,698,244 (GRCm39) L186H Het
Usp17lc T C 7: 103,067,524 (GRCm39) F273S probably benign Het
Vwa5b2 T C 16: 20,419,516 (GRCm39) S620P probably damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGTGGGTAGTGAGGATTCATC -3'
(R):5'- CTTGGAGATGCAGTGTCTTCAC -3'

Sequencing Primer
(F):5'- ATTCATCTATCGCTGGAGGC -3'
(R):5'- TCTTCACGGGGATAAAAGATGCAC -3'
Posted On 2021-04-30