Incidental Mutation 'R8815:Gprc6a'
ID672681
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene NameG protein-coupled receptor, family C, group 6, member A
Synonyms
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8815 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location51614823-51631461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51620983 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 488 (V488A)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: V488A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: V488A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: V313A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,784 Q106H probably damaging Het
A430078G23Rik C A 8: 3,380,410 H94Q probably benign Het
Acad9 T C 3: 36,085,441 C397R probably damaging Het
Ankfn1 T G 11: 89,391,776 R348S probably damaging Het
Ankrd61 A G 5: 143,894,518 C28R probably benign Het
Ano5 C T 7: 51,544,800 R94* probably null Het
Apela A T 8: 65,036,938 F10I unknown Het
Arhgap31 T C 16: 38,609,428 S362G probably benign Het
Astn2 A T 4: 65,912,597 L585Q possibly damaging Het
Atf3 G T 1: 191,177,367 A35D probably benign Het
Atp10b A T 11: 43,203,151 R507S possibly damaging Het
Brip1 A C 11: 86,189,772 V156G probably benign Het
Ccdc27 T A 4: 154,026,748 M636L probably benign Het
Ceacam5 T A 7: 17,759,360 N769K possibly damaging Het
Cklf C T 8: 104,250,928 probably benign Het
Cpeb4 G A 11: 31,920,546 V474M probably damaging Het
Dip2c T A 13: 9,623,798 C1091* probably null Het
Eef1akmt4 T A 16: 20,618,538 I210N possibly damaging Het
Fbxo38 A T 18: 62,533,516 H195Q probably damaging Het
Fbxw14 G A 9: 109,276,237 R287* probably null Het
Fes A G 7: 80,383,871 S211P possibly damaging Het
Fry G T 5: 150,394,138 R861L possibly damaging Het
Gm14226 G A 2: 155,024,618 W165* probably null Het
Gm21671 A G 5: 25,953,193 S54P probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Helb A T 10: 120,112,787 C26S possibly damaging Het
Icam1 A T 9: 21,026,566 I300F probably benign Het
Ip6k1 A G 9: 108,041,012 N181S probably benign Het
Itga2b C A 11: 102,460,861 R546L possibly damaging Het
Kif27 A T 13: 58,329,004 Y611N probably damaging Het
Lpcat2 A G 8: 92,914,351 I475V possibly damaging Het
Lrit2 A G 14: 37,072,530 K517R probably benign Het
Lrp1b A T 2: 40,665,159 I4085N Het
Lrrc32 T A 7: 98,499,035 S341T probably damaging Het
Lrrn2 T A 1: 132,939,093 I632K possibly damaging Het
Mettl22 A G 16: 8,482,314 Q194R probably benign Het
Mfhas1 T A 8: 35,590,240 V623E probably damaging Het
Mitd1 T C 1: 37,890,234 D26G probably damaging Het
Myo1a C T 10: 127,710,174 T222M probably benign Het
Naf1 A G 8: 66,864,681 K275R possibly damaging Het
Nf1 T C 11: 79,441,665 L765P probably damaging Het
Olfr198 T A 16: 59,201,901 H175L possibly damaging Het
Olfr360 G T 2: 37,068,417 M37I probably benign Het
Olfr68 A G 7: 103,777,856 L163P possibly damaging Het
Olfr823 T A 10: 130,111,939 I284F probably damaging Het
Pappa A G 4: 65,181,110 H622R probably benign Het
Pcdhb4 A T 18: 37,309,002 Y455F probably damaging Het
Pepd A G 7: 34,971,691 Y220C probably damaging Het
Pias3 T C 3: 96,700,065 I172T probably damaging Het
Polq T A 16: 37,033,531 H415Q probably damaging Het
Pp2d1 A T 17: 53,507,869 M609K probably benign Het
Prss22 T A 17: 23,996,688 T87S probably benign Het
Ptprf C A 4: 118,237,928 V254L possibly damaging Het
Ripply3 A G 16: 94,335,864 E128G possibly damaging Het
Rrm2 A C 12: 24,710,471 I185L possibly damaging Het
Sdc3 T A 4: 130,819,025 S232T probably benign Het
Slx4 G C 16: 3,985,594 P1119A probably benign Het
Smc5 C T 19: 23,244,058 R369Q probably damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Sptbn4 G A 7: 27,407,232 Q924* probably null Het
Srcap G C 7: 127,558,865 D2638H unknown Het
Srsf12 T C 4: 33,226,045 S103P possibly damaging Het
Tanc1 A G 2: 59,790,841 T335A possibly damaging Het
Them4 C T 3: 94,324,303 T149I probably damaging Het
Trpc7 T C 13: 56,822,499 Y424C possibly damaging Het
Ttn A T 2: 76,867,900 L186H Het
Ttn C T 2: 76,798,020 D14599N probably damaging Het
Usp17lc T C 7: 103,418,317 F273S probably benign Het
Vwa5b2 T C 16: 20,600,766 S620P probably damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGTGGGTAGTGAGGATTCATC -3'
(R):5'- CTTGGAGATGCAGTGTCTTCAC -3'

Sequencing Primer
(F):5'- ATTCATCTATCGCTGGAGGC -3'
(R):5'- TCTTCACGGGGATAAAAGATGCAC -3'
Posted On2021-04-30