Incidental Mutation 'R8815:Dip2c'
ID672692
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R8815 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 9623798 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1091 (C1091*)
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably null
Transcript: ENSMUST00000166299
AA Change: C1092*
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: C1092*

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169960
AA Change: C1062*
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: C1062*

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174552
AA Change: C1091*
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: C1091*

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000222280
AA Change: C194*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,784 Q106H probably damaging Het
A430078G23Rik C A 8: 3,380,410 H94Q probably benign Het
Acad9 T C 3: 36,085,441 C397R probably damaging Het
Ankfn1 T G 11: 89,391,776 R348S probably damaging Het
Ankrd61 A G 5: 143,894,518 C28R probably benign Het
Ano5 C T 7: 51,544,800 R94* probably null Het
Apela A T 8: 65,036,938 F10I unknown Het
Arhgap31 T C 16: 38,609,428 S362G probably benign Het
Astn2 A T 4: 65,912,597 L585Q possibly damaging Het
Atf3 G T 1: 191,177,367 A35D probably benign Het
Atp10b A T 11: 43,203,151 R507S possibly damaging Het
Brip1 A C 11: 86,189,772 V156G probably benign Het
Ccdc27 T A 4: 154,026,748 M636L probably benign Het
Ceacam5 T A 7: 17,759,360 N769K possibly damaging Het
Cklf C T 8: 104,250,928 probably benign Het
Cpeb4 G A 11: 31,920,546 V474M probably damaging Het
Eef1akmt4 T A 16: 20,618,538 I210N possibly damaging Het
Fbxo38 A T 18: 62,533,516 H195Q probably damaging Het
Fbxw14 G A 9: 109,276,237 R287* probably null Het
Fes A G 7: 80,383,871 S211P possibly damaging Het
Fry G T 5: 150,394,138 R861L possibly damaging Het
Gm14226 G A 2: 155,024,618 W165* probably null Het
Gm21671 A G 5: 25,953,193 S54P probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gprc6a A G 10: 51,620,983 V488A probably benign Het
Helb A T 10: 120,112,787 C26S possibly damaging Het
Icam1 A T 9: 21,026,566 I300F probably benign Het
Ip6k1 A G 9: 108,041,012 N181S probably benign Het
Itga2b C A 11: 102,460,861 R546L possibly damaging Het
Kif27 A T 13: 58,329,004 Y611N probably damaging Het
Lpcat2 A G 8: 92,914,351 I475V possibly damaging Het
Lrit2 A G 14: 37,072,530 K517R probably benign Het
Lrp1b A T 2: 40,665,159 I4085N Het
Lrrc32 T A 7: 98,499,035 S341T probably damaging Het
Lrrn2 T A 1: 132,939,093 I632K possibly damaging Het
Mettl22 A G 16: 8,482,314 Q194R probably benign Het
Mfhas1 T A 8: 35,590,240 V623E probably damaging Het
Mitd1 T C 1: 37,890,234 D26G probably damaging Het
Myo1a C T 10: 127,710,174 T222M probably benign Het
Naf1 A G 8: 66,864,681 K275R possibly damaging Het
Nf1 T C 11: 79,441,665 L765P probably damaging Het
Olfr198 T A 16: 59,201,901 H175L possibly damaging Het
Olfr360 G T 2: 37,068,417 M37I probably benign Het
Olfr68 A G 7: 103,777,856 L163P possibly damaging Het
Olfr823 T A 10: 130,111,939 I284F probably damaging Het
Pappa A G 4: 65,181,110 H622R probably benign Het
Pcdhb4 A T 18: 37,309,002 Y455F probably damaging Het
Pepd A G 7: 34,971,691 Y220C probably damaging Het
Pias3 T C 3: 96,700,065 I172T probably damaging Het
Polq T A 16: 37,033,531 H415Q probably damaging Het
Pp2d1 A T 17: 53,507,869 M609K probably benign Het
Prss22 T A 17: 23,996,688 T87S probably benign Het
Ptprf C A 4: 118,237,928 V254L possibly damaging Het
Ripply3 A G 16: 94,335,864 E128G possibly damaging Het
Rrm2 A C 12: 24,710,471 I185L possibly damaging Het
Sdc3 T A 4: 130,819,025 S232T probably benign Het
Slx4 G C 16: 3,985,594 P1119A probably benign Het
Smc5 C T 19: 23,244,058 R369Q probably damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Sptbn4 G A 7: 27,407,232 Q924* probably null Het
Srcap G C 7: 127,558,865 D2638H unknown Het
Srsf12 T C 4: 33,226,045 S103P possibly damaging Het
Tanc1 A G 2: 59,790,841 T335A possibly damaging Het
Them4 C T 3: 94,324,303 T149I probably damaging Het
Trpc7 T C 13: 56,822,499 Y424C possibly damaging Het
Ttn C T 2: 76,798,020 D14599N probably damaging Het
Ttn A T 2: 76,867,900 L186H Het
Usp17lc T C 7: 103,418,317 F273S probably benign Het
Vwa5b2 T C 16: 20,600,766 S620P probably damaging Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
R7575:Dip2c UTSW 13 9628012 missense probably damaging 0.97
R7642:Dip2c UTSW 13 9622705 critical splice donor site probably null
R7687:Dip2c UTSW 13 9604581 missense probably benign 0.00
R7699:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7700:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7715:Dip2c UTSW 13 9614391 missense probably damaging 1.00
R7842:Dip2c UTSW 13 9606533 critical splice donor site probably null
R7845:Dip2c UTSW 13 9609044 missense probably damaging 1.00
R8354:Dip2c UTSW 13 9621882 missense probably benign 0.05
R8685:Dip2c UTSW 13 9637125 missense probably benign 0.01
R8779:Dip2c UTSW 13 9610809 missense probably damaging 0.98
R8786:Dip2c UTSW 13 9615794 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCTCAGCTCTTGGGAATTAAAGTTG -3'
(R):5'- AGGTAAGCCAGTGTGTCAGG -3'

Sequencing Primer
(F):5'- GTGTACTTTTAACCTTTGGGACAC -3'
(R):5'- TGTAGATCTGGGCAGGCC -3'
Posted On2021-04-30