Incidental Mutation 'R8815:Lrit2'
ID672695
Institutional Source Beutler Lab
Gene Symbol Lrit2
Ensembl Gene ENSMUSG00000043418
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 2
SynonymsA930010E21Rik, Lrrc22
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8815 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location37067929-37073743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37072530 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 517 (K517R)
Ref Sequence ENSEMBL: ENSMUSP00000056642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057176]
Predicted Effect probably benign
Transcript: ENSMUST00000057176
AA Change: K517R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000056642
Gene: ENSMUSG00000043418
AA Change: K517R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 23 59 7.74e-2 SMART
LRR 78 101 9.96e-1 SMART
LRR_TYP 102 125 8.94e-3 SMART
LRR 126 149 2.03e1 SMART
LRR_TYP 150 173 7.67e-2 SMART
LRRCT 200 251 7.12e-7 SMART
IGc2 265 334 2.05e-9 SMART
FN3 362 443 5.94e0 SMART
transmembrane domain 463 485 N/A INTRINSIC
low complexity region 538 546 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,784 Q106H probably damaging Het
A430078G23Rik C A 8: 3,380,410 H94Q probably benign Het
Acad9 T C 3: 36,085,441 C397R probably damaging Het
Ankfn1 T G 11: 89,391,776 R348S probably damaging Het
Ankrd61 A G 5: 143,894,518 C28R probably benign Het
Ano5 C T 7: 51,544,800 R94* probably null Het
Apela A T 8: 65,036,938 F10I unknown Het
Arhgap31 T C 16: 38,609,428 S362G probably benign Het
Astn2 A T 4: 65,912,597 L585Q possibly damaging Het
Atf3 G T 1: 191,177,367 A35D probably benign Het
Atp10b A T 11: 43,203,151 R507S possibly damaging Het
Brip1 A C 11: 86,189,772 V156G probably benign Het
Ccdc27 T A 4: 154,026,748 M636L probably benign Het
Ceacam5 T A 7: 17,759,360 N769K possibly damaging Het
Cklf C T 8: 104,250,928 probably benign Het
Cpeb4 G A 11: 31,920,546 V474M probably damaging Het
Dip2c T A 13: 9,623,798 C1091* probably null Het
Eef1akmt4 T A 16: 20,618,538 I210N possibly damaging Het
Fbxo38 A T 18: 62,533,516 H195Q probably damaging Het
Fbxw14 G A 9: 109,276,237 R287* probably null Het
Fes A G 7: 80,383,871 S211P possibly damaging Het
Fry G T 5: 150,394,138 R861L possibly damaging Het
Gm14226 G A 2: 155,024,618 W165* probably null Het
Gm21671 A G 5: 25,953,193 S54P probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gprc6a A G 10: 51,620,983 V488A probably benign Het
Helb A T 10: 120,112,787 C26S possibly damaging Het
Icam1 A T 9: 21,026,566 I300F probably benign Het
Ip6k1 A G 9: 108,041,012 N181S probably benign Het
Itga2b C A 11: 102,460,861 R546L possibly damaging Het
Kif27 A T 13: 58,329,004 Y611N probably damaging Het
Lpcat2 A G 8: 92,914,351 I475V possibly damaging Het
Lrp1b A T 2: 40,665,159 I4085N Het
Lrrc32 T A 7: 98,499,035 S341T probably damaging Het
Lrrn2 T A 1: 132,939,093 I632K possibly damaging Het
Mettl22 A G 16: 8,482,314 Q194R probably benign Het
Mfhas1 T A 8: 35,590,240 V623E probably damaging Het
Mitd1 T C 1: 37,890,234 D26G probably damaging Het
Myo1a C T 10: 127,710,174 T222M probably benign Het
Naf1 A G 8: 66,864,681 K275R possibly damaging Het
Nf1 T C 11: 79,441,665 L765P probably damaging Het
Olfr198 T A 16: 59,201,901 H175L possibly damaging Het
Olfr360 G T 2: 37,068,417 M37I probably benign Het
Olfr68 A G 7: 103,777,856 L163P possibly damaging Het
Olfr823 T A 10: 130,111,939 I284F probably damaging Het
Pappa A G 4: 65,181,110 H622R probably benign Het
Pcdhb4 A T 18: 37,309,002 Y455F probably damaging Het
Pepd A G 7: 34,971,691 Y220C probably damaging Het
Pias3 T C 3: 96,700,065 I172T probably damaging Het
Polq T A 16: 37,033,531 H415Q probably damaging Het
Pp2d1 A T 17: 53,507,869 M609K probably benign Het
Prss22 T A 17: 23,996,688 T87S probably benign Het
Ptprf C A 4: 118,237,928 V254L possibly damaging Het
Ripply3 A G 16: 94,335,864 E128G possibly damaging Het
Rrm2 A C 12: 24,710,471 I185L possibly damaging Het
Sdc3 T A 4: 130,819,025 S232T probably benign Het
Slx4 G C 16: 3,985,594 P1119A probably benign Het
Smc5 C T 19: 23,244,058 R369Q probably damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Sptbn4 G A 7: 27,407,232 Q924* probably null Het
Srcap G C 7: 127,558,865 D2638H unknown Het
Srsf12 T C 4: 33,226,045 S103P possibly damaging Het
Tanc1 A G 2: 59,790,841 T335A possibly damaging Het
Them4 C T 3: 94,324,303 T149I probably damaging Het
Trpc7 T C 13: 56,822,499 Y424C possibly damaging Het
Ttn A T 2: 76,867,900 L186H Het
Ttn C T 2: 76,798,020 D14599N probably damaging Het
Usp17lc T C 7: 103,418,317 F273S probably benign Het
Vwa5b2 T C 16: 20,600,766 S620P probably damaging Het
Other mutations in Lrit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Lrit2 APN 14 37071963 missense probably benign 0.31
IGL01475:Lrit2 APN 14 37069094 missense probably damaging 1.00
IGL02080:Lrit2 APN 14 37069074 missense probably damaging 0.99
IGL02141:Lrit2 APN 14 37068074 unclassified probably benign
IGL02479:Lrit2 APN 14 37072278 missense probably damaging 0.99
IGL02715:Lrit2 APN 14 37072548 missense probably benign 0.00
R0114:Lrit2 UTSW 14 37068045 splice site probably null
R1344:Lrit2 UTSW 14 37068556 missense probably benign 0.32
R1529:Lrit2 UTSW 14 37068827 missense probably benign 0.12
R1641:Lrit2 UTSW 14 37069148 missense probably benign 0.34
R2105:Lrit2 UTSW 14 37071956 missense probably damaging 1.00
R4365:Lrit2 UTSW 14 37072119 missense probably damaging 1.00
R4645:Lrit2 UTSW 14 37072475 missense probably benign
R5226:Lrit2 UTSW 14 37072353 missense probably damaging 1.00
R5377:Lrit2 UTSW 14 37069183 missense possibly damaging 0.59
R5387:Lrit2 UTSW 14 37072259 missense probably damaging 1.00
R5840:Lrit2 UTSW 14 37069005 missense possibly damaging 0.64
R5881:Lrit2 UTSW 14 37072235 missense probably benign 0.02
R6499:Lrit2 UTSW 14 37068810 missense probably damaging 0.98
R6863:Lrit2 UTSW 14 37071944 missense probably damaging 0.99
R7307:Lrit2 UTSW 14 37072199 missense probably benign 0.00
R7316:Lrit2 UTSW 14 37068858 missense probably damaging 1.00
R7491:Lrit2 UTSW 14 37068910 missense possibly damaging 0.83
R7525:Lrit2 UTSW 14 37072493 missense possibly damaging 0.76
R7640:Lrit2 UTSW 14 37072124 missense probably damaging 1.00
R8228:Lrit2 UTSW 14 37069191 missense probably damaging 1.00
R8397:Lrit2 UTSW 14 37069077 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGTGACAGGCAAAGACAGTG -3'
(R):5'- AGAACACAGTGGCTGCTCAAG -3'

Sequencing Primer
(F):5'- CTAGAGGGTCGTGAGCACCTC -3'
(R):5'- AGTGGCTGCTCAAGAAATCC -3'
Posted On2021-04-30