Incidental Mutation 'T0970:Txnrd2'
ID67270
Institutional Source Beutler Lab
Gene Symbol Txnrd2
Ensembl Gene ENSMUSG00000075704
Gene Namethioredoxin reductase 2
SynonymsTR beta, TR3, TGR, ESTM573010
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #T0970 (G3) of strain 713
Quality Score92
Status Validated
Chromosome16
Chromosomal Location18426384-18479073 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18441773 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 185 (V185A)
Ref Sequence ENSEMBL: ENSMUSP00000136373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115604] [ENSMUST00000115605] [ENSMUST00000115606] [ENSMUST00000126778] [ENSMUST00000144233] [ENSMUST00000177856] [ENSMUST00000178093] [ENSMUST00000205679] [ENSMUST00000206151] [ENSMUST00000206606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115604
AA Change: V188A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111267
Gene: ENSMUSG00000075704
AA Change: V188A

DomainStartEndE-ValueType
low complexity region 8 36 N/A INTRINSIC
Pfam:FAD_binding_2 41 95 9.7e-9 PFAM
Pfam:GIDA 41 200 2.5e-6 PFAM
Pfam:Pyr_redox_2 41 323 7.8e-29 PFAM
Pfam:Pyr_redox_3 43 253 4.1e-9 PFAM
Pfam:Pyr_redox 220 302 4.9e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000115605
AA Change: V169A
SMART Domains Protein: ENSMUSP00000111268
Gene: ENSMUSG00000075704
AA Change: V169A

DomainStartEndE-ValueType
low complexity region 8 36 N/A INTRINSIC
Pfam:FAD_binding_2 41 95 8.4e-7 PFAM
Pfam:GIDA 41 208 1.8e-4 PFAM
Pfam:Pyr_redox_2 41 365 1.2e-39 PFAM
Pfam:Pyr_redox_3 43 253 8.2e-7 PFAM
Pfam:Pyr_redox 220 302 5.7e-13 PFAM
Pfam:Pyr_redox_dim 388 477 3.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115606
AA Change: V188A

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111269
Gene: ENSMUSG00000075704
AA Change: V188A

DomainStartEndE-ValueType
low complexity region 8 36 N/A INTRINSIC
Pfam:Pyr_redox_2 40 375 2.4e-71 PFAM
Pfam:FAD_binding_2 41 90 2.9e-8 PFAM
Pfam:Pyr_redox 220 299 2.1e-15 PFAM
Pfam:Pyr_redox_dim 395 508 7.6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126778
Predicted Effect probably benign
Transcript: ENSMUST00000131303
Predicted Effect unknown
Transcript: ENSMUST00000138310
AA Change: V32A
Predicted Effect possibly damaging
Transcript: ENSMUST00000144233
AA Change: V152A

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000177856
AA Change: V185A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136402
Gene: ENSMUSG00000075704
AA Change: V185A

DomainStartEndE-ValueType
low complexity region 8 36 N/A INTRINSIC
Pfam:FAD_binding_2 41 95 1.3e-8 PFAM
Pfam:GIDA 41 240 6.2e-7 PFAM
Pfam:Pyr_redox_2 41 365 3.9e-38 PFAM
Pfam:Pyr_redox 226 302 1.3e-10 PFAM
Pfam:Pyr_redox_dim 395 508 1.2e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178093
AA Change: V185A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136373
Gene: ENSMUSG00000075704
AA Change: V185A

DomainStartEndE-ValueType
low complexity region 8 36 N/A INTRINSIC
Pfam:FAD_binding_2 41 95 9e-7 PFAM
Pfam:GIDA 41 201 1.9e-4 PFAM
Pfam:Pyr_redox_2 41 365 2.3e-36 PFAM
Pfam:Pyr_redox 226 302 1.2e-8 PFAM
Pfam:Pyr_redox_dim 388 477 3.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205679
AA Change: V166A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206151
AA Change: V188A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206606
AA Change: V188A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: This gene product belongs to the family of pyridine nucleotide-disulfide oxidoreductases. It is a mitochondrial enzyme that catalyzes the reduction of thioredoxin, and is implicated in the defense against oxidative stress. This protein contains a selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon, which normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die at E13 due to severe anemia and growth retardation, resulting from perturbed cardiac development and augmented apoptosis of hematopoietic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A T 10: 88,981,190 L591* probably null Het
Aqp4 A G 18: 15,399,883 L51P probably damaging Het
Cemip A T 7: 83,983,146 C403S probably damaging Het
Cfap74 G T 4: 155,463,117 probably null Het
Glis3 G A 19: 28,530,932 R551W probably damaging Het
Gm11232 T A 4: 71,756,503 Y254F possibly damaging Het
Gm11492 A T 11: 87,567,732 T311S probably damaging Het
Map3k14 G T 11: 103,224,298 C837* probably null Het
Mrc2 A C 11: 105,347,627 E1200A probably benign Het
Nfix T C 8: 84,726,483 N314S possibly damaging Het
Nphp4 T C 4: 152,556,379 S1068P probably damaging Het
Nup98 A C 7: 102,186,752 probably benign Het
Olfr1340 A G 4: 118,726,267 R7G probably benign Het
Pcdhac2 T C 18: 37,145,335 V456A possibly damaging Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Prss38 A G 11: 59,373,148 V246A possibly damaging Het
Rnf26 C G 9: 44,112,072 R172P probably damaging Het
Serinc3 TATCATC TATC 2: 163,627,915 probably benign Het
Spire1 C A 18: 67,501,063 probably null Het
Tex2 T A 11: 106,546,946 I633F unknown Het
Tle2 A G 10: 81,580,285 D108G possibly damaging Het
Unc45b C A 11: 82,922,888 H374N probably benign Het
Wtap T C 17: 12,969,390 probably benign Het
Other mutations in Txnrd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Txnrd2 APN 16 18438351 missense probably damaging 1.00
IGL00337:Txnrd2 APN 16 18477769 missense probably damaging 1.00
IGL01988:Txnrd2 APN 16 18456018 splice site probably benign
IGL02708:Txnrd2 APN 16 18468840 missense probably benign 0.38
IGL02949:Txnrd2 APN 16 18477706 missense probably benign 0.00
IGL03292:Txnrd2 APN 16 18477729 missense possibly damaging 0.53
R0610:Txnrd2 UTSW 16 18472882 missense probably damaging 0.96
R0723:Txnrd2 UTSW 16 18440879 splice site probably benign
R1625:Txnrd2 UTSW 16 18438366 missense probably damaging 1.00
R3000:Txnrd2 UTSW 16 18454513 missense probably damaging 1.00
R4180:Txnrd2 UTSW 16 18426425 splice site probably null
R4569:Txnrd2 UTSW 16 18456206 missense probably benign
R4570:Txnrd2 UTSW 16 18468804 missense probably benign 0.02
R4773:Txnrd2 UTSW 16 18440819 missense probably benign 0.15
R5385:Txnrd2 UTSW 16 18477692 missense probably damaging 1.00
R6074:Txnrd2 UTSW 16 18437547 missense probably damaging 1.00
R7247:Txnrd2 UTSW 16 18456072 missense probably damaging 0.99
R7630:Txnrd2 UTSW 16 18438390 missense possibly damaging 0.69
R8343:Txnrd2 UTSW 16 18426541 missense unknown
R8383:Txnrd2 UTSW 16 18472864 missense possibly damaging 0.83
R8428:Txnrd2 UTSW 16 18456298 missense unknown
R8852:Txnrd2 UTSW 16 18440851 missense possibly damaging 0.54
T0975:Txnrd2 UTSW 16 18475565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTGAGACCCCTGCTCTGTGAC -3'
(R):5'- GACATGAATCCCAGGTGATCGGAAG -3'

Sequencing Primer
(F):5'- CCTGCTCTGTGACTTAGACATAAGG -3'
(R):5'- cggacaacacagaactaaacac -3'
Posted On2013-09-03