Incidental Mutation 'T0970:Wtap'
ID67271
Institutional Source Beutler Lab
Gene Symbol Wtap
Ensembl Gene ENSMUSG00000060475
Gene NameWilms tumour 1-associating protein
Synonyms9430038B09Rik, 2810408K05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #T0970 (G3) of strain 713
Quality Score141
Status Validated
Chromosome17
Chromosomal Location12966796-12992546 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 12969390 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007007] [ENSMUST00000159551] [ENSMUST00000159986] [ENSMUST00000160781]
Predicted Effect probably benign
Transcript: ENSMUST00000007007
SMART Domains Protein: ENSMUSP00000007007
Gene: ENSMUSG00000060475

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
coiled coil region 177 248 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159551
SMART Domains Protein: ENSMUSP00000124205
Gene: ENSMUSG00000060475

DomainStartEndE-ValueType
Pfam:Wtap 1 248 2.8e-157 PFAM
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159986
SMART Domains Protein: ENSMUSP00000123961
Gene: ENSMUSG00000060475

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160781
SMART Domains Protein: ENSMUSP00000124138
Gene: ENSMUSG00000060475

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Wilms tumor suppressor gene WT1 appears to play a role in both transcriptional and posttranscriptional regulation of certain cellular genes. This gene encodes a WT1-associating protein, which is a ubiquitously expressed nuclear protein. Like WT1 protein, this protein is localized throughout the nucleoplasm as well as in speckles and partially colocalizes with splicing factors. Alternative splicing of this gene results in several transcript variants encoding three different isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a mutation display lethality during embryogenesis with abnormalities appearing during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A T 10: 88,981,190 L591* probably null Het
Aqp4 A G 18: 15,399,883 L51P probably damaging Het
Cemip A T 7: 83,983,146 C403S probably damaging Het
Cfap74 G T 4: 155,463,117 probably null Het
Glis3 G A 19: 28,530,932 R551W probably damaging Het
Gm11232 T A 4: 71,756,503 Y254F possibly damaging Het
Gm11492 A T 11: 87,567,732 T311S probably damaging Het
Map3k14 G T 11: 103,224,298 C837* probably null Het
Mrc2 A C 11: 105,347,627 E1200A probably benign Het
Nfix T C 8: 84,726,483 N314S possibly damaging Het
Nphp4 T C 4: 152,556,379 S1068P probably damaging Het
Nup98 A C 7: 102,186,752 probably benign Het
Olfr1340 A G 4: 118,726,267 R7G probably benign Het
Pcdhac2 T C 18: 37,145,335 V456A possibly damaging Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Prss38 A G 11: 59,373,148 V246A possibly damaging Het
Rnf26 C G 9: 44,112,072 R172P probably damaging Het
Serinc3 TATCATC TATC 2: 163,627,915 probably benign Het
Spire1 C A 18: 67,501,063 probably null Het
Tex2 T A 11: 106,546,946 I633F unknown Het
Tle2 A G 10: 81,580,285 D108G possibly damaging Het
Txnrd2 T C 16: 18,441,773 V185A probably damaging Het
Unc45b C A 11: 82,922,888 H374N probably benign Het
Other mutations in Wtap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Wtap APN 17 12967895 missense probably benign 0.08
IGL01867:Wtap APN 17 12969455 missense probably benign 0.00
IGL02379:Wtap APN 17 12969449 missense probably benign
IGL02437:Wtap APN 17 12967733 missense probably benign
IGL02975:Wtap APN 17 12983511 missense possibly damaging 0.85
ANU22:Wtap UTSW 17 12967895 missense probably benign 0.08
R1457:Wtap UTSW 17 12981744 splice site probably null
R1799:Wtap UTSW 17 12980884 missense possibly damaging 0.96
R2240:Wtap UTSW 17 12975465 nonsense probably null
R2328:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R2332:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R3426:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R4382:Wtap UTSW 17 12975420 missense probably damaging 0.99
R4703:Wtap UTSW 17 12980824 missense probably benign 0.23
R4879:Wtap UTSW 17 12969435 missense probably damaging 0.99
R4956:Wtap UTSW 17 12967536 missense probably benign 0.06
R5044:Wtap UTSW 17 12967638 missense possibly damaging 0.47
R6366:Wtap UTSW 17 12968058 splice site probably null
R6813:Wtap UTSW 17 12967510 missense probably damaging 0.96
R7324:Wtap UTSW 17 12980946 missense possibly damaging 0.91
R7443:Wtap UTSW 17 12980934 missense probably benign 0.05
R7810:Wtap UTSW 17 12980910 missense probably damaging 0.99
X0067:Wtap UTSW 17 12985929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCTTTCTTTGCAACCAAGAACC -3'
(R):5'- TGGCGAAGTGTCGAATGCTTATCC -3'

Sequencing Primer
(F):5'- GAAGACACTGTTAGTGATGCTC -3'
(R):5'- TGTCGAATGCTTATCCAGGAGAAC -3'
Posted On2013-09-03