Incidental Mutation 'R8816:Atrn'
ID 672717
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
MMRRC Submission 068726-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8816 (G1)
Quality Score 99.0078
Status Not validated
Chromosome 2
Chromosomal Location 130748415-130872253 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 130748798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 106 (N106K)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781] [ENSMUST00000146975]
AlphaFold Q9WU60
Predicted Effect probably damaging
Transcript: ENSMUST00000028781
AA Change: N106K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: N106K

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146975
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,127,513 (GRCm39) H348L probably benign Het
Alpk1 A T 3: 127,478,024 (GRCm39) Y74* probably null Het
Ass1 T C 2: 31,383,189 (GRCm39) probably benign Het
Atp8b4 C T 2: 126,214,084 (GRCm39) probably benign Het
Bicdl1 T A 5: 115,862,804 (GRCm39) Q150H probably damaging Het
Bltp3b T C 10: 89,626,597 (GRCm39) probably benign Het
Cdhr4 T C 9: 107,872,791 (GRCm39) V280A possibly damaging Het
Cfap54 C T 10: 92,714,454 (GRCm39) V2642I unknown Het
Chd2 T C 7: 73,140,245 (GRCm39) H661R probably damaging Het
Cntnap2 A G 6: 46,833,076 (GRCm39) D763G possibly damaging Het
Csnk1g2 T C 10: 80,474,093 (GRCm39) C160R probably damaging Het
Cyb5r4 T C 9: 86,904,286 (GRCm39) S19P probably benign Het
Cyp4a30b G A 4: 115,309,834 (GRCm39) V12M probably benign Het
Dpp6 C T 5: 27,930,711 (GRCm39) P848S probably benign Het
Dzip1 T C 14: 119,159,785 (GRCm39) Y141C probably benign Het
Eif2b3 C A 4: 116,928,052 (GRCm39) Q424K probably benign Het
Fbxw14 G A 9: 109,105,305 (GRCm39) R287* probably null Het
Fcgbp T G 7: 27,784,412 (GRCm39) S157R probably benign Het
Fmnl2 T G 2: 53,004,214 (GRCm39) V642G unknown Het
Gpr119 C T X: 47,762,276 (GRCm39) R287Q possibly damaging Het
Grm7 C T 6: 111,230,966 (GRCm39) T463I possibly damaging Het
Haus4 G A 14: 54,779,710 (GRCm39) R305C probably benign Het
Htr1f A G 16: 64,746,537 (GRCm39) S252P probably benign Het
Ino80b T C 6: 83,098,861 (GRCm39) Q359R probably damaging Het
Itgad C A 7: 127,797,542 (GRCm39) Y924* probably null Het
Itpr2 A G 6: 146,142,710 (GRCm39) Y1703H probably damaging Het
Kif5c T A 2: 49,584,799 (GRCm39) V174E probably damaging Het
Kifc2 A G 15: 76,548,371 (GRCm39) E405G probably damaging Het
Klk1b3 T C 7: 43,851,668 (GRCm39) V242A possibly damaging Het
Kndc1 T C 7: 139,517,909 (GRCm39) F1615S probably damaging Het
Lmtk2 T A 5: 144,112,793 (GRCm39) L1171* probably null Het
Myh10 A G 11: 68,693,778 (GRCm39) E1530G probably damaging Het
Nav3 T A 10: 109,699,721 (GRCm39) S258C possibly damaging Het
Nudcd3 C T 11: 6,100,587 (GRCm39) G186S probably damaging Het
Or9s15 T A 1: 92,524,768 (GRCm39) C176S probably damaging Het
Otog C T 7: 45,950,905 (GRCm39) S374F possibly damaging Het
P2ry2 T A 7: 100,647,763 (GRCm39) I181F possibly damaging Het
Pde11a T C 2: 76,121,577 (GRCm39) I335V probably benign Het
Phyhip A C 14: 70,704,375 (GRCm39) D198A probably damaging Het
Pik3r5 A T 11: 68,385,060 (GRCm39) Y655F probably damaging Het
Rab6a T C 7: 100,279,145 (GRCm39) I95T possibly damaging Het
Sgsm1 T C 5: 113,435,097 (GRCm39) E99G probably damaging Het
Skint10 A T 4: 112,603,892 (GRCm39) F98L probably benign Het
Slc35c2 A G 2: 165,119,378 (GRCm39) S321P probably benign Het
Smyd1 T A 6: 71,192,868 (GRCm39) E447V probably damaging Het
Smyd4 T C 11: 75,281,232 (GRCm39) V235A probably benign Het
Sod2 A G 17: 13,227,253 (GRCm39) Y69C probably benign Het
Spns1 G A 7: 125,971,593 (GRCm39) S319F possibly damaging Het
Tfap2b A G 1: 19,284,337 (GRCm39) S82G probably benign Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Tln2 A G 9: 67,128,799 (GRCm39) I1430T probably damaging Het
Trio G T 15: 27,741,357 (GRCm39) N2680K probably damaging Het
Trmt10c A T 16: 55,854,522 (GRCm39) V371D probably damaging Het
Trpm3 T C 19: 22,965,580 (GRCm39) S1692P probably damaging Het
Usb1 G T 8: 96,071,984 (GRCm39) C228F probably benign Het
Veph1 G T 3: 66,065,646 (GRCm39) H474N probably benign Het
Wls A G 3: 159,639,928 (GRCm39) T520A possibly damaging Het
Ywhae T C 11: 75,623,878 (GRCm39) Y9H probably damaging Het
Zranb3 C T 1: 127,964,347 (GRCm39) V127M possibly damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130,799,999 (GRCm39) missense probably damaging 1.00
IGL00571:Atrn APN 2 130,836,968 (GRCm39) missense probably damaging 1.00
IGL01092:Atrn APN 2 130,789,556 (GRCm39) nonsense probably null
IGL01572:Atrn APN 2 130,844,715 (GRCm39) missense probably damaging 1.00
IGL01924:Atrn APN 2 130,777,485 (GRCm39) missense probably damaging 1.00
IGL02116:Atrn APN 2 130,800,009 (GRCm39) missense probably damaging 1.00
IGL02372:Atrn APN 2 130,844,674 (GRCm39) splice site probably benign
IGL02390:Atrn APN 2 130,862,897 (GRCm39) missense possibly damaging 0.82
IGL02548:Atrn APN 2 130,814,202 (GRCm39) missense probably damaging 1.00
IGL02749:Atrn APN 2 130,789,654 (GRCm39) splice site probably benign
IGL02749:Atrn APN 2 130,812,064 (GRCm39) nonsense probably null
BB010:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
BB020:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R0026:Atrn UTSW 2 130,799,840 (GRCm39) missense probably damaging 1.00
R0403:Atrn UTSW 2 130,748,779 (GRCm39) missense probably damaging 1.00
R0479:Atrn UTSW 2 130,841,085 (GRCm39) nonsense probably null
R0544:Atrn UTSW 2 130,828,746 (GRCm39) missense probably damaging 1.00
R0570:Atrn UTSW 2 130,822,054 (GRCm39) missense probably benign 0.01
R0606:Atrn UTSW 2 130,748,776 (GRCm39) missense possibly damaging 0.90
R0617:Atrn UTSW 2 130,837,005 (GRCm39) critical splice donor site probably null
R0658:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R1108:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1112:Atrn UTSW 2 130,841,081 (GRCm39) missense probably benign 0.04
R1219:Atrn UTSW 2 130,862,927 (GRCm39) missense possibly damaging 0.90
R1422:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1524:Atrn UTSW 2 130,799,000 (GRCm39) missense probably benign 0.15
R1653:Atrn UTSW 2 130,777,544 (GRCm39) missense probably benign
R1795:Atrn UTSW 2 130,814,208 (GRCm39) missense probably benign
R1807:Atrn UTSW 2 130,824,692 (GRCm39) missense possibly damaging 0.94
R1920:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1921:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1935:Atrn UTSW 2 130,799,955 (GRCm39) missense probably damaging 1.00
R1982:Atrn UTSW 2 130,812,142 (GRCm39) missense probably benign
R2000:Atrn UTSW 2 130,777,508 (GRCm39) missense probably damaging 1.00
R2143:Atrn UTSW 2 130,799,916 (GRCm39) missense probably benign 0.03
R2336:Atrn UTSW 2 130,799,874 (GRCm39) missense probably damaging 1.00
R2679:Atrn UTSW 2 130,803,595 (GRCm39) critical splice donor site probably null
R3426:Atrn UTSW 2 130,862,876 (GRCm39) missense probably benign 0.06
R3909:Atrn UTSW 2 130,836,127 (GRCm39) missense probably damaging 1.00
R4077:Atrn UTSW 2 130,806,850 (GRCm39) critical splice donor site probably null
R4162:Atrn UTSW 2 130,836,148 (GRCm39) splice site probably benign
R4195:Atrn UTSW 2 130,775,332 (GRCm39) missense probably damaging 1.00
R4364:Atrn UTSW 2 130,812,128 (GRCm39) missense probably benign 0.39
R4465:Atrn UTSW 2 130,802,388 (GRCm39) missense probably benign 0.08
R4510:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4511:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4527:Atrn UTSW 2 130,815,424 (GRCm39) missense probably benign 0.10
R4586:Atrn UTSW 2 130,823,962 (GRCm39) missense probably damaging 1.00
R4592:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R4658:Atrn UTSW 2 130,775,349 (GRCm39) missense probably damaging 1.00
R4735:Atrn UTSW 2 130,862,910 (GRCm39) missense probably benign 0.06
R4960:Atrn UTSW 2 130,836,967 (GRCm39) nonsense probably null
R4999:Atrn UTSW 2 130,817,874 (GRCm39) missense probably damaging 1.00
R5066:Atrn UTSW 2 130,836,113 (GRCm39) missense possibly damaging 0.60
R5080:Atrn UTSW 2 130,812,044 (GRCm39) missense possibly damaging 0.95
R5141:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R5256:Atrn UTSW 2 130,787,939 (GRCm39) missense probably benign 0.39
R5494:Atrn UTSW 2 130,864,995 (GRCm39) missense probably damaging 1.00
R5678:Atrn UTSW 2 130,811,936 (GRCm39) missense probably damaging 0.96
R5752:Atrn UTSW 2 130,748,464 (GRCm39) unclassified probably benign
R5931:Atrn UTSW 2 130,775,356 (GRCm39) missense possibly damaging 0.56
R6023:Atrn UTSW 2 130,862,900 (GRCm39) missense probably benign 0.25
R6176:Atrn UTSW 2 130,788,011 (GRCm39) missense probably benign 0.31
R6377:Atrn UTSW 2 130,821,889 (GRCm39) missense probably damaging 1.00
R6433:Atrn UTSW 2 130,864,947 (GRCm39) missense probably damaging 1.00
R7226:Atrn UTSW 2 130,828,664 (GRCm39) missense probably damaging 0.99
R7402:Atrn UTSW 2 130,789,520 (GRCm39) missense probably damaging 1.00
R7541:Atrn UTSW 2 130,803,491 (GRCm39) missense possibly damaging 0.46
R7587:Atrn UTSW 2 130,822,034 (GRCm39) missense probably damaging 1.00
R7872:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R7910:Atrn UTSW 2 130,806,807 (GRCm39) missense probably benign 0.04
R7913:Atrn UTSW 2 130,812,131 (GRCm39) missense probably damaging 1.00
R7933:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R8044:Atrn UTSW 2 130,777,449 (GRCm39) missense probably damaging 1.00
R8079:Atrn UTSW 2 130,855,561 (GRCm39) missense probably null 1.00
R8093:Atrn UTSW 2 130,817,908 (GRCm39) missense probably benign 0.00
R8203:Atrn UTSW 2 130,802,469 (GRCm39) missense probably benign 0.00
R8234:Atrn UTSW 2 130,864,920 (GRCm39) critical splice acceptor site probably null
R8462:Atrn UTSW 2 130,777,504 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,846,494 (GRCm39) missense probably damaging 1.00
R8831:Atrn UTSW 2 130,748,521 (GRCm39) missense probably benign 0.22
R8937:Atrn UTSW 2 130,841,157 (GRCm39) missense probably benign 0.00
R9161:Atrn UTSW 2 130,777,470 (GRCm39) missense probably damaging 1.00
R9722:Atrn UTSW 2 130,803,536 (GRCm39) missense probably damaging 1.00
R9786:Atrn UTSW 2 130,786,809 (GRCm39) missense probably damaging 1.00
RF009:Atrn UTSW 2 130,748,842 (GRCm39) missense probably benign 0.12
X0024:Atrn UTSW 2 130,800,059 (GRCm39) missense probably damaging 1.00
Z1088:Atrn UTSW 2 130,815,319 (GRCm39) missense probably benign
Z1176:Atrn UTSW 2 130,788,113 (GRCm39) missense probably benign 0.27
Z1177:Atrn UTSW 2 130,787,962 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGTTCATCCGCGCTAAGAC -3'
(R):5'- CTACCCTCGCGATTTCAAGC -3'

Sequencing Primer
(F):5'- TCAGCCCCAGGAAGATGGTG -3'
(R):5'- GCGATTTCAAGCCCTGCAC -3'
Posted On 2021-04-30