Mutagenetix > Incidental Mutation

Incidental Mutation 'R8816:Atrn'

672718

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8816 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 131004574 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1256 (V1256A)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably damaging
Transcript: ENSMUST00000028781
AA Change: V1256A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: V1256A

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	A	11: 110,236,687	H348L	probably benign	Het
Alpk1	A	T	3: 127,684,375	Y74*	probably null	Het
Ass1	T	C	2: 31,493,177		probably benign	Het
Atp8b4	C	T	2: 126,372,164		probably benign	Het
Bicdl1	T	A	5: 115,724,745	Q150H	probably damaging	Het
Cdhr4	T	C	9: 107,995,592	V280A	possibly damaging	Het
Cfap54	C	T	10: 92,878,592	V2642I	unknown	Het
Chd2	T	C	7: 73,490,497	H661R	probably damaging	Het
Cntnap2	A	G	6: 46,856,142	D763G	possibly damaging	Het
Csnk1g2	T	C	10: 80,638,259	C160R	probably damaging	Het
Cyb5r4	T	C	9: 87,022,233	S19P	probably benign	Het
Cyp4a30b	G	A	4: 115,452,637	V12M	probably benign	Het
Dpp6	C	T	5: 27,725,713	P848S	probably benign	Het
Dzip1	T	C	14: 118,922,373	Y141C	probably benign	Het
Eif2b3	C	A	4: 117,070,855	Q424K	probably benign	Het
Fbxw14	G	A	9: 109,276,237	R287*	probably null	Het
Fcgbp	T	G	7: 28,084,987	S157R	probably benign	Het
Fmnl2	T	G	2: 53,114,202	V642G	unknown	Het
Gpr119	C	T	X: 48,673,399	R287Q	possibly damaging	Het
Grm7	C	T	6: 111,254,005	T463I	possibly damaging	Het
Haus4	G	A	14: 54,542,253	R305C	probably benign	Het
Htr1f	A	G	16: 64,926,174	S252P	probably benign	Het
Ino80b	T	C	6: 83,121,880	Q359R	probably damaging	Het
Itgad	C	A	7: 128,198,370	Y924*	probably null	Het
Itpr2	A	G	6: 146,241,212	Y1703H	probably damaging	Het
Kif5c	T	A	2: 49,694,787	V174E	probably damaging	Het
Kifc2	A	G	15: 76,664,171	E405G	probably damaging	Het
Klk1b3	T	C	7: 44,202,244	V242A	possibly damaging	Het
Kndc1	T	C	7: 139,937,996	F1615S	probably damaging	Het
Lmtk2	T	A	5: 144,175,975	L1171*	probably null	Het
Myh10	A	G	11: 68,802,952	E1530G	probably damaging	Het
Nav3	T	A	10: 109,863,860	S258C	possibly damaging	Het
Nudcd3	C	T	11: 6,150,587	G186S	probably damaging	Het
Olfr1411	T	A	1: 92,597,046	C176S	probably damaging	Het
Otog	C	T	7: 46,301,481	S374F	possibly damaging	Het
P2ry2	T	A	7: 100,998,556	I181F	possibly damaging	Het
Pde11a	T	C	2: 76,291,233	I335V	probably benign	Het
Phyhip	A	C	14: 70,466,935	D198A	probably damaging	Het
Pik3r5	A	T	11: 68,494,234	Y655F	probably damaging	Het
Rab6a	T	C	7: 100,629,938	I95T	possibly damaging	Het
Sgsm1	T	C	5: 113,287,231	E99G	probably damaging	Het
Skint10	A	T	4: 112,746,695	F98L	probably benign	Het
Slc35c2	A	G	2: 165,277,458	S321P	probably benign	Het
Smyd1	T	A	6: 71,215,884	E447V	probably damaging	Het
Smyd4	T	C	11: 75,390,406	V235A	probably benign	Het
Sod2	A	G	17: 13,008,366	Y69C	probably benign	Het
Spns1	G	A	7: 126,372,421	S319F	possibly damaging	Het
Tfap2b	A	G	1: 19,214,113	S82G	probably benign	Het
Tln2	C	A	9: 67,221,411	E1465D	possibly damaging	Het
Tln2	A	G	9: 67,221,517	I1430T	probably damaging	Het
Trio	G	T	15: 27,741,271	N2680K	probably damaging	Het
Trmt10c	A	T	16: 56,034,159	V371D	probably damaging	Het
Trpm3	T	C	19: 22,988,216	S1692P	probably damaging	Het
Uhrf1bp1l	T	C	10: 89,790,735		probably benign	Het
Usb1	G	T	8: 95,345,356	C228F	probably benign	Het
Veph1	G	T	3: 66,158,225	H474N	probably benign	Het
Wls	A	G	3: 159,934,292	T520A	possibly damaging	Het
Ywhae	T	C	11: 75,733,052	Y9H	probably damaging	Het
Zranb3	C	T	1: 128,036,610	V127M	possibly damaging	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTGGGTTAGAGACTGAAGCTC -3'
(R):5'- CCTGCTACTCAGTCTATGGC -3'

Sequencing Primer
(F):5'- CCTCATTACTAGTGCGCAAAGATTC -3'
(R):5'- CTGCTACTCAGTCTATGGCAAAGATC -3'

Posted On

2021-04-30