Incidental Mutation 'R8816:Atrn'
ID672718
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Nameattractin
SynonymsMgca
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8816 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130906495-131030333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131004574 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1256 (V1256A)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably damaging
Transcript: ENSMUST00000028781
AA Change: V1256A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: V1256A

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,236,687 H348L probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Ass1 T C 2: 31,493,177 probably benign Het
Atp8b4 C T 2: 126,372,164 probably benign Het
Bicdl1 T A 5: 115,724,745 Q150H probably damaging Het
Cdhr4 T C 9: 107,995,592 V280A possibly damaging Het
Cfap54 C T 10: 92,878,592 V2642I unknown Het
Chd2 T C 7: 73,490,497 H661R probably damaging Het
Cntnap2 A G 6: 46,856,142 D763G possibly damaging Het
Csnk1g2 T C 10: 80,638,259 C160R probably damaging Het
Cyb5r4 T C 9: 87,022,233 S19P probably benign Het
Cyp4a30b G A 4: 115,452,637 V12M probably benign Het
Dpp6 C T 5: 27,725,713 P848S probably benign Het
Dzip1 T C 14: 118,922,373 Y141C probably benign Het
Eif2b3 C A 4: 117,070,855 Q424K probably benign Het
Fbxw14 G A 9: 109,276,237 R287* probably null Het
Fcgbp T G 7: 28,084,987 S157R probably benign Het
Fmnl2 T G 2: 53,114,202 V642G unknown Het
Gpr119 C T X: 48,673,399 R287Q possibly damaging Het
Grm7 C T 6: 111,254,005 T463I possibly damaging Het
Haus4 G A 14: 54,542,253 R305C probably benign Het
Htr1f A G 16: 64,926,174 S252P probably benign Het
Ino80b T C 6: 83,121,880 Q359R probably damaging Het
Itgad C A 7: 128,198,370 Y924* probably null Het
Itpr2 A G 6: 146,241,212 Y1703H probably damaging Het
Kif5c T A 2: 49,694,787 V174E probably damaging Het
Kifc2 A G 15: 76,664,171 E405G probably damaging Het
Klk1b3 T C 7: 44,202,244 V242A possibly damaging Het
Kndc1 T C 7: 139,937,996 F1615S probably damaging Het
Lmtk2 T A 5: 144,175,975 L1171* probably null Het
Myh10 A G 11: 68,802,952 E1530G probably damaging Het
Nav3 T A 10: 109,863,860 S258C possibly damaging Het
Nudcd3 C T 11: 6,150,587 G186S probably damaging Het
Olfr1411 T A 1: 92,597,046 C176S probably damaging Het
Otog C T 7: 46,301,481 S374F possibly damaging Het
P2ry2 T A 7: 100,998,556 I181F possibly damaging Het
Pde11a T C 2: 76,291,233 I335V probably benign Het
Phyhip A C 14: 70,466,935 D198A probably damaging Het
Pik3r5 A T 11: 68,494,234 Y655F probably damaging Het
Rab6a T C 7: 100,629,938 I95T possibly damaging Het
Sgsm1 T C 5: 113,287,231 E99G probably damaging Het
Skint10 A T 4: 112,746,695 F98L probably benign Het
Slc35c2 A G 2: 165,277,458 S321P probably benign Het
Smyd1 T A 6: 71,215,884 E447V probably damaging Het
Smyd4 T C 11: 75,390,406 V235A probably benign Het
Sod2 A G 17: 13,008,366 Y69C probably benign Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Tfap2b A G 1: 19,214,113 S82G probably benign Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Tln2 A G 9: 67,221,517 I1430T probably damaging Het
Trio G T 15: 27,741,271 N2680K probably damaging Het
Trmt10c A T 16: 56,034,159 V371D probably damaging Het
Trpm3 T C 19: 22,988,216 S1692P probably damaging Het
Uhrf1bp1l T C 10: 89,790,735 probably benign Het
Usb1 G T 8: 95,345,356 C228F probably benign Het
Veph1 G T 3: 66,158,225 H474N probably benign Het
Wls A G 3: 159,934,292 T520A possibly damaging Het
Ywhae T C 11: 75,733,052 Y9H probably damaging Het
Zranb3 C T 1: 128,036,610 V127M possibly damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
BB010:Atrn UTSW 2 130995066 missense probably damaging 1.00
BB020:Atrn UTSW 2 130995066 missense probably damaging 1.00
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0403:Atrn UTSW 2 130906859 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1112:Atrn UTSW 2 130999161 missense probably benign 0.04
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R1982:Atrn UTSW 2 130970222 missense probably benign
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4510:Atrn UTSW 2 130935577 nonsense probably null
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5141:Atrn UTSW 2 130999130 intron probably benign
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6023:Atrn UTSW 2 131020980 missense probably benign 0.25
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
R7402:Atrn UTSW 2 130947600 missense probably damaging 1.00
R7541:Atrn UTSW 2 130961571 missense possibly damaging 0.46
R7587:Atrn UTSW 2 130980114 missense probably damaging 1.00
R7872:Atrn UTSW 2 130970227 critical splice donor site probably null
R7910:Atrn UTSW 2 130964887 missense probably benign 0.04
R7913:Atrn UTSW 2 130970211 missense probably damaging 1.00
R7933:Atrn UTSW 2 130995066 missense probably damaging 1.00
R8044:Atrn UTSW 2 130935529 missense probably damaging 1.00
R8079:Atrn UTSW 2 131013641 missense probably null 1.00
R8093:Atrn UTSW 2 130975988 missense probably benign 0.00
R8203:Atrn UTSW 2 130960549 missense probably benign 0.00
R8234:Atrn UTSW 2 131023000 critical splice acceptor site probably null
R8462:Atrn UTSW 2 130935584 missense probably damaging 1.00
R8816:Atrn UTSW 2 130906878 missense probably damaging 1.00
R8831:Atrn UTSW 2 130906601 missense probably benign 0.22
R8937:Atrn UTSW 2 130999237 missense probably benign 0.00
RF009:Atrn UTSW 2 130906922 missense probably benign 0.12
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Z1176:Atrn UTSW 2 130946193 missense probably benign 0.27
Z1177:Atrn UTSW 2 130946042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGGGTTAGAGACTGAAGCTC -3'
(R):5'- CCTGCTACTCAGTCTATGGC -3'

Sequencing Primer
(F):5'- CCTCATTACTAGTGCGCAAAGATTC -3'
(R):5'- CTGCTACTCAGTCTATGGCAAAGATC -3'
Posted On2021-04-30