Incidental Mutation 'R8816:Sgsm1'
ID 672727
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8816 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113287231 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 99 (E99G)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048112
AA Change: E99G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: E99G

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112325
AA Change: E99G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: E99G

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154248
AA Change: E99G

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: E99G

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,236,687 H348L probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Ass1 T C 2: 31,493,177 probably benign Het
Atp8b4 C T 2: 126,372,164 probably benign Het
Atrn C A 2: 130,906,878 N106K probably damaging Het
Atrn T C 2: 131,004,574 V1256A probably damaging Het
Bicdl1 T A 5: 115,724,745 Q150H probably damaging Het
Cdhr4 T C 9: 107,995,592 V280A possibly damaging Het
Cfap54 C T 10: 92,878,592 V2642I unknown Het
Chd2 T C 7: 73,490,497 H661R probably damaging Het
Cntnap2 A G 6: 46,856,142 D763G possibly damaging Het
Csnk1g2 T C 10: 80,638,259 C160R probably damaging Het
Cyb5r4 T C 9: 87,022,233 S19P probably benign Het
Cyp4a30b G A 4: 115,452,637 V12M probably benign Het
Dpp6 C T 5: 27,725,713 P848S probably benign Het
Dzip1 T C 14: 118,922,373 Y141C probably benign Het
Eif2b3 C A 4: 117,070,855 Q424K probably benign Het
Fbxw14 G A 9: 109,276,237 R287* probably null Het
Fcgbp T G 7: 28,084,987 S157R probably benign Het
Fmnl2 T G 2: 53,114,202 V642G unknown Het
Gpr119 C T X: 48,673,399 R287Q possibly damaging Het
Grm7 C T 6: 111,254,005 T463I possibly damaging Het
Haus4 G A 14: 54,542,253 R305C probably benign Het
Htr1f A G 16: 64,926,174 S252P probably benign Het
Ino80b T C 6: 83,121,880 Q359R probably damaging Het
Itgad C A 7: 128,198,370 Y924* probably null Het
Itpr2 A G 6: 146,241,212 Y1703H probably damaging Het
Kif5c T A 2: 49,694,787 V174E probably damaging Het
Kifc2 A G 15: 76,664,171 E405G probably damaging Het
Klk1b3 T C 7: 44,202,244 V242A possibly damaging Het
Kndc1 T C 7: 139,937,996 F1615S probably damaging Het
Lmtk2 T A 5: 144,175,975 L1171* probably null Het
Myh10 A G 11: 68,802,952 E1530G probably damaging Het
Nav3 T A 10: 109,863,860 S258C possibly damaging Het
Nudcd3 C T 11: 6,150,587 G186S probably damaging Het
Olfr1411 T A 1: 92,597,046 C176S probably damaging Het
Otog C T 7: 46,301,481 S374F possibly damaging Het
P2ry2 T A 7: 100,998,556 I181F possibly damaging Het
Pde11a T C 2: 76,291,233 I335V probably benign Het
Phyhip A C 14: 70,466,935 D198A probably damaging Het
Pik3r5 A T 11: 68,494,234 Y655F probably damaging Het
Rab6a T C 7: 100,629,938 I95T possibly damaging Het
Skint10 A T 4: 112,746,695 F98L probably benign Het
Slc35c2 A G 2: 165,277,458 S321P probably benign Het
Smyd1 T A 6: 71,215,884 E447V probably damaging Het
Smyd4 T C 11: 75,390,406 V235A probably benign Het
Sod2 A G 17: 13,008,366 Y69C probably benign Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Tfap2b A G 1: 19,214,113 S82G probably benign Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Tln2 A G 9: 67,221,517 I1430T probably damaging Het
Trio G T 15: 27,741,271 N2680K probably damaging Het
Trmt10c A T 16: 56,034,159 V371D probably damaging Het
Trpm3 T C 19: 22,988,216 S1692P probably damaging Het
Uhrf1bp1l T C 10: 89,790,735 probably benign Het
Usb1 G T 8: 95,345,356 C228F probably benign Het
Veph1 G T 3: 66,158,225 H474N probably benign Het
Wls A G 3: 159,934,292 T520A possibly damaging Het
Ywhae T C 11: 75,733,052 Y9H probably damaging Het
Zranb3 C T 1: 128,036,610 V127M possibly damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113288859 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113280335 missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113276032 critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113279231 missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113280341 missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113310552 missense probably benign
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCGCCTTTAAGACCGGTG -3'
(R):5'- ATGGGATTCTCTGCACTGTCG -3'

Sequencing Primer
(F):5'- CCTTTAAGACCGGTGGTAGGAG -3'
(R):5'- TGGCGACTGTGCACAAG -3'
Posted On 2021-04-30