Mutagenetix > Incidental Mutation

Incidental Mutation 'R8816:Cntnap2'

672730

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

068726-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8816 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46856142 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 763 (D763G)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114641
AA Change: D763G

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: D763G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	A	11: 110,236,687	H348L	probably benign	Het
Alpk1	A	T	3: 127,684,375	Y74*	probably null	Het
Ass1	T	C	2: 31,493,177		probably benign	Het
Atp8b4	C	T	2: 126,372,164		probably benign	Het
Atrn	C	A	2: 130,906,878	N106K	probably damaging	Het
Atrn	T	C	2: 131,004,574	V1256A	probably damaging	Het
Bicdl1	T	A	5: 115,724,745	Q150H	probably damaging	Het
Cdhr4	T	C	9: 107,995,592	V280A	possibly damaging	Het
Cfap54	C	T	10: 92,878,592	V2642I	unknown	Het
Chd2	T	C	7: 73,490,497	H661R	probably damaging	Het
Csnk1g2	T	C	10: 80,638,259	C160R	probably damaging	Het
Cyb5r4	T	C	9: 87,022,233	S19P	probably benign	Het
Cyp4a30b	G	A	4: 115,452,637	V12M	probably benign	Het
Dpp6	C	T	5: 27,725,713	P848S	probably benign	Het
Dzip1	T	C	14: 118,922,373	Y141C	probably benign	Het
Eif2b3	C	A	4: 117,070,855	Q424K	probably benign	Het
Fbxw14	G	A	9: 109,276,237	R287*	probably null	Het
Fcgbp	T	G	7: 28,084,987	S157R	probably benign	Het
Fmnl2	T	G	2: 53,114,202	V642G	unknown	Het
Gpr119	C	T	X: 48,673,399	R287Q	possibly damaging	Het
Grm7	C	T	6: 111,254,005	T463I	possibly damaging	Het
Haus4	G	A	14: 54,542,253	R305C	probably benign	Het
Htr1f	A	G	16: 64,926,174	S252P	probably benign	Het
Ino80b	T	C	6: 83,121,880	Q359R	probably damaging	Het
Itgad	C	A	7: 128,198,370	Y924*	probably null	Het
Itpr2	A	G	6: 146,241,212	Y1703H	probably damaging	Het
Kif5c	T	A	2: 49,694,787	V174E	probably damaging	Het
Kifc2	A	G	15: 76,664,171	E405G	probably damaging	Het
Klk1b3	T	C	7: 44,202,244	V242A	possibly damaging	Het
Kndc1	T	C	7: 139,937,996	F1615S	probably damaging	Het
Lmtk2	T	A	5: 144,175,975	L1171*	probably null	Het
Myh10	A	G	11: 68,802,952	E1530G	probably damaging	Het
Nav3	T	A	10: 109,863,860	S258C	possibly damaging	Het
Nudcd3	C	T	11: 6,150,587	G186S	probably damaging	Het
Olfr1411	T	A	1: 92,597,046	C176S	probably damaging	Het
Otog	C	T	7: 46,301,481	S374F	possibly damaging	Het
P2ry2	T	A	7: 100,998,556	I181F	possibly damaging	Het
Pde11a	T	C	2: 76,291,233	I335V	probably benign	Het
Phyhip	A	C	14: 70,466,935	D198A	probably damaging	Het
Pik3r5	A	T	11: 68,494,234	Y655F	probably damaging	Het
Rab6a	T	C	7: 100,629,938	I95T	possibly damaging	Het
Sgsm1	T	C	5: 113,287,231	E99G	probably damaging	Het
Skint10	A	T	4: 112,746,695	F98L	probably benign	Het
Slc35c2	A	G	2: 165,277,458	S321P	probably benign	Het
Smyd1	T	A	6: 71,215,884	E447V	probably damaging	Het
Smyd4	T	C	11: 75,390,406	V235A	probably benign	Het
Sod2	A	G	17: 13,008,366	Y69C	probably benign	Het
Spns1	G	A	7: 126,372,421	S319F	possibly damaging	Het
Tfap2b	A	G	1: 19,214,113	S82G	probably benign	Het
Tln2	C	A	9: 67,221,411	E1465D	possibly damaging	Het
Tln2	A	G	9: 67,221,517	I1430T	probably damaging	Het
Trio	G	T	15: 27,741,271	N2680K	probably damaging	Het
Trmt10c	A	T	16: 56,034,159	V371D	probably damaging	Het
Trpm3	T	C	19: 22,988,216	S1692P	probably damaging	Het
Uhrf1bp1l	T	C	10: 89,790,735		probably benign	Het
Usb1	G	T	8: 95,345,356	C228F	probably benign	Het
Veph1	G	T	3: 66,158,225	H474N	probably benign	Het
Wls	A	G	3: 159,934,292	T520A	possibly damaging	Het
Ywhae	T	C	11: 75,733,052	Y9H	probably damaging	Het
Zranb3	C	T	1: 128,036,610	V127M	possibly damaging	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TTCCATCAGATGACCATGCC -3'
(R):5'- ACACACATGTTTTCTGGCATC -3'

Sequencing Primer
(F):5'- ATGACCATGCCAGAGTTGC -3'
(R):5'- TCTTCTGAACAGCCTGGAGAC -3'

Posted On

2021-04-30