Incidental Mutation 'R8816:Cyb5r4'
ID 672747
Institutional Source Beutler Lab
Gene Symbol Cyb5r4
Ensembl Gene ENSMUSG00000032872
Gene Name cytochrome b5 reductase 4
Synonyms b5/b5r, Ncb5or, B5+B5R, 2810034J18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8816 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 87022014-87077774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87022233 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 19 (S19P)
Ref Sequence ENSEMBL: ENSMUSP00000126119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058846] [ENSMUST00000168529]
AlphaFold Q3TDX8
Predicted Effect probably benign
Transcript: ENSMUST00000058846
SMART Domains Protein: ENSMUSP00000055369
Gene: ENSMUSG00000047897

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Ripply 33 118 2.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168529
AA Change: S19P

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126119
Gene: ENSMUSG00000032872
AA Change: S19P

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.1e-16 PFAM
Pfam:FAD_binding_6 284 391 4.1e-22 PFAM
Pfam:NAD_binding_1 402 508 4.7e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NCB5OR is a flavohemoprotein that contains functional domains found in both cytochrome b5 (CYB5A; MIM 613218) and CYB5 reductase (CYB5R3; MIM 613213) (Zhu et al., 1999 [PubMed 10611283]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mice exhibit defects in glucose homeostasis and pancreatic abnormalities consistent with symptoms of diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,236,687 H348L probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Ass1 T C 2: 31,493,177 probably benign Het
Atp8b4 C T 2: 126,372,164 probably benign Het
Atrn C A 2: 130,906,878 N106K probably damaging Het
Atrn T C 2: 131,004,574 V1256A probably damaging Het
Bicdl1 T A 5: 115,724,745 Q150H probably damaging Het
Cdhr4 T C 9: 107,995,592 V280A possibly damaging Het
Cfap54 C T 10: 92,878,592 V2642I unknown Het
Chd2 T C 7: 73,490,497 H661R probably damaging Het
Cntnap2 A G 6: 46,856,142 D763G possibly damaging Het
Csnk1g2 T C 10: 80,638,259 C160R probably damaging Het
Cyp4a30b G A 4: 115,452,637 V12M probably benign Het
Dpp6 C T 5: 27,725,713 P848S probably benign Het
Dzip1 T C 14: 118,922,373 Y141C probably benign Het
Eif2b3 C A 4: 117,070,855 Q424K probably benign Het
Fbxw14 G A 9: 109,276,237 R287* probably null Het
Fcgbp T G 7: 28,084,987 S157R probably benign Het
Fmnl2 T G 2: 53,114,202 V642G unknown Het
Gpr119 C T X: 48,673,399 R287Q possibly damaging Het
Grm7 C T 6: 111,254,005 T463I possibly damaging Het
Haus4 G A 14: 54,542,253 R305C probably benign Het
Htr1f A G 16: 64,926,174 S252P probably benign Het
Ino80b T C 6: 83,121,880 Q359R probably damaging Het
Itgad C A 7: 128,198,370 Y924* probably null Het
Itpr2 A G 6: 146,241,212 Y1703H probably damaging Het
Kif5c T A 2: 49,694,787 V174E probably damaging Het
Kifc2 A G 15: 76,664,171 E405G probably damaging Het
Klk1b3 T C 7: 44,202,244 V242A possibly damaging Het
Kndc1 T C 7: 139,937,996 F1615S probably damaging Het
Lmtk2 T A 5: 144,175,975 L1171* probably null Het
Myh10 A G 11: 68,802,952 E1530G probably damaging Het
Nav3 T A 10: 109,863,860 S258C possibly damaging Het
Nudcd3 C T 11: 6,150,587 G186S probably damaging Het
Olfr1411 T A 1: 92,597,046 C176S probably damaging Het
Otog C T 7: 46,301,481 S374F possibly damaging Het
P2ry2 T A 7: 100,998,556 I181F possibly damaging Het
Pde11a T C 2: 76,291,233 I335V probably benign Het
Phyhip A C 14: 70,466,935 D198A probably damaging Het
Pik3r5 A T 11: 68,494,234 Y655F probably damaging Het
Rab6a T C 7: 100,629,938 I95T possibly damaging Het
Sgsm1 T C 5: 113,287,231 E99G probably damaging Het
Skint10 A T 4: 112,746,695 F98L probably benign Het
Slc35c2 A G 2: 165,277,458 S321P probably benign Het
Smyd1 T A 6: 71,215,884 E447V probably damaging Het
Smyd4 T C 11: 75,390,406 V235A probably benign Het
Sod2 A G 17: 13,008,366 Y69C probably benign Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Tfap2b A G 1: 19,214,113 S82G probably benign Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Tln2 A G 9: 67,221,517 I1430T probably damaging Het
Trio G T 15: 27,741,271 N2680K probably damaging Het
Trmt10c A T 16: 56,034,159 V371D probably damaging Het
Trpm3 T C 19: 22,988,216 S1692P probably damaging Het
Uhrf1bp1l T C 10: 89,790,735 probably benign Het
Usb1 G T 8: 95,345,356 C228F probably benign Het
Veph1 G T 3: 66,158,225 H474N probably benign Het
Wls A G 3: 159,934,292 T520A possibly damaging Het
Ywhae T C 11: 75,733,052 Y9H probably damaging Het
Zranb3 C T 1: 128,036,610 V127M possibly damaging Het
Other mutations in Cyb5r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Cyb5r4 APN 9 87059452 critical splice donor site probably null
cello UTSW 9 87029538 nonsense probably null
viol UTSW 9 87059077 critical splice donor site probably null
PIT1430001:Cyb5r4 UTSW 9 87038738 missense probably benign
R0040:Cyb5r4 UTSW 9 87066742 splice site probably null
R0373:Cyb5r4 UTSW 9 87027040 missense probably damaging 0.99
R0755:Cyb5r4 UTSW 9 87029572 missense probably damaging 1.00
R1381:Cyb5r4 UTSW 9 87022233 missense probably benign 0.03
R1488:Cyb5r4 UTSW 9 87029538 nonsense probably null
R1510:Cyb5r4 UTSW 9 87066643 intron probably benign
R1856:Cyb5r4 UTSW 9 87022209 missense possibly damaging 0.61
R1857:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1858:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1870:Cyb5r4 UTSW 9 87040409 missense probably benign 0.00
R1876:Cyb5r4 UTSW 9 87055814 missense probably damaging 1.00
R1959:Cyb5r4 UTSW 9 87055849 missense possibly damaging 0.82
R2036:Cyb5r4 UTSW 9 87042879 splice site probably benign
R2895:Cyb5r4 UTSW 9 87040399 nonsense probably null
R4226:Cyb5r4 UTSW 9 87057229 missense probably damaging 0.99
R4655:Cyb5r4 UTSW 9 87059429 missense probably benign 0.01
R4971:Cyb5r4 UTSW 9 87057171 missense possibly damaging 0.80
R5038:Cyb5r4 UTSW 9 87059077 critical splice donor site probably null
R5155:Cyb5r4 UTSW 9 87040403 missense probably benign 0.08
R5187:Cyb5r4 UTSW 9 87026948 missense possibly damaging 0.92
R5654:Cyb5r4 UTSW 9 87047480 missense probably damaging 0.98
R5659:Cyb5r4 UTSW 9 87055828 missense probably benign 0.22
R5926:Cyb5r4 UTSW 9 87057261 missense probably benign 0.04
R6083:Cyb5r4 UTSW 9 87057168 missense probably damaging 1.00
R6610:Cyb5r4 UTSW 9 87059417 missense probably benign
R7311:Cyb5r4 UTSW 9 87055782 missense probably damaging 1.00
R7662:Cyb5r4 UTSW 9 87027038 missense possibly damaging 0.83
R7748:Cyb5r4 UTSW 9 87032381 missense probably damaging 1.00
R8171:Cyb5r4 UTSW 9 87042810 missense possibly damaging 0.81
R8253:Cyb5r4 UTSW 9 87059055 missense probably damaging 1.00
R8369:Cyb5r4 UTSW 9 87040433 missense probably benign 0.00
RF001:Cyb5r4 UTSW 9 87040416 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF013:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF014:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF024:Cyb5r4 UTSW 9 87040435 small insertion probably benign
RF025:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF026:Cyb5r4 UTSW 9 87040433 small insertion probably benign
RF027:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF031:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF032:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040417 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040447 nonsense probably null
RF036:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF038:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF040:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040411 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF045:Cyb5r4 UTSW 9 87040402 nonsense probably null
RF045:Cyb5r4 UTSW 9 87040447 small insertion probably benign
RF052:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF053:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040414 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF056:Cyb5r4 UTSW 9 87040410 small insertion probably benign
RF059:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF060:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF061:Cyb5r4 UTSW 9 87040435 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGAGTGAGCCTTTCCTCTGAC -3'
(R):5'- AGCCTGGATCTTTGACCGTAAAG -3'

Sequencing Primer
(F):5'- CCTCTCGTGAGCGTGATTGC -3'
(R):5'- CTTTGACCGTAAAGAACAAAAGACTG -3'
Posted On 2021-04-30