Incidental Mutation 'T0970:Glis3'
ID67275
Institutional Source Beutler Lab
Gene Symbol Glis3
Ensembl Gene ENSMUSG00000052942
Gene NameGLIS family zinc finger 3
SynonymsE330013K21Rik, 4833409N03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #T0970 (G3) of strain 713
Quality Score225
Status Validated
Chromosome19
Chromosomal Location28258851-28680077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28530932 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 551 (R551W)
Ref Sequence ENSEMBL: ENSMUSP00000124635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065113] [ENSMUST00000112612] [ENSMUST00000159178] [ENSMUST00000160376] [ENSMUST00000161328] [ENSMUST00000162022]
Predicted Effect probably benign
Transcript: ENSMUST00000065113
SMART Domains Protein: ENSMUSP00000066953
Gene: ENSMUSG00000052942

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112612
AA Change: R551W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108231
Gene: ENSMUSG00000052942
AA Change: R551W

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
low complexity region 203 222 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
ZnF_C2H2 500 525 1.07e0 SMART
ZnF_C2H2 534 561 6.13e-1 SMART
ZnF_C2H2 567 591 3.89e-3 SMART
ZnF_C2H2 597 621 1.45e-2 SMART
ZnF_C2H2 627 651 9.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159178
SMART Domains Protein: ENSMUSP00000124823
Gene: ENSMUSG00000052942

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
low complexity region 203 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160376
SMART Domains Protein: ENSMUSP00000124143
Gene: ENSMUSG00000052942

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161026
Predicted Effect probably benign
Transcript: ENSMUST00000161328
SMART Domains Protein: ENSMUSP00000125721
Gene: ENSMUSG00000052942

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
low complexity region 203 222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162022
AA Change: R551W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124635
Gene: ENSMUSG00000052942
AA Change: R551W

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
low complexity region 203 222 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
ZnF_C2H2 500 525 1.07e0 SMART
ZnF_C2H2 534 561 6.13e-1 SMART
ZnF_C2H2 567 591 3.89e-3 SMART
ZnF_C2H2 597 621 1.45e-2 SMART
ZnF_C2H2 627 651 9.08e-4 SMART
low complexity region 700 709 N/A INTRINSIC
low complexity region 722 746 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear protein which contains multiple C2H2-type zinc finger domains. This protein functions as both a repressor and activator of transcription and is specifically involved in the transcriptional regulation of insulin. It is thought to enhance GLI-RE-dependent transcription by binding to the GLI-RE consensus sequence (GACCACCCAC). Mutations in a similar gene in human have been associated with neonatal diabetes and congenital hypothyroidism (NDH). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit postnatal lethality associated with neonatal diabetes and polycystic kidney disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A T 10: 88,981,190 L591* probably null Het
Aqp4 A G 18: 15,399,883 L51P probably damaging Het
Cemip A T 7: 83,983,146 C403S probably damaging Het
Cfap74 G T 4: 155,463,117 probably null Het
Gm11232 T A 4: 71,756,503 Y254F possibly damaging Het
Gm11492 A T 11: 87,567,732 T311S probably damaging Het
Map3k14 G T 11: 103,224,298 C837* probably null Het
Mrc2 A C 11: 105,347,627 E1200A probably benign Het
Nfix T C 8: 84,726,483 N314S possibly damaging Het
Nphp4 T C 4: 152,556,379 S1068P probably damaging Het
Nup98 A C 7: 102,186,752 probably benign Het
Olfr1340 A G 4: 118,726,267 R7G probably benign Het
Pcdhac2 T C 18: 37,145,335 V456A possibly damaging Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Prss38 A G 11: 59,373,148 V246A possibly damaging Het
Rnf26 C G 9: 44,112,072 R172P probably damaging Het
Serinc3 TATCATC TATC 2: 163,627,915 probably benign Het
Spire1 C A 18: 67,501,063 probably null Het
Tex2 T A 11: 106,546,946 I633F unknown Het
Tle2 A G 10: 81,580,285 D108G possibly damaging Het
Txnrd2 T C 16: 18,441,773 V185A probably damaging Het
Unc45b C A 11: 82,922,888 H374N probably benign Het
Wtap T C 17: 12,969,390 probably benign Het
Other mutations in Glis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Glis3 APN 19 28540264 missense probably damaging 1.00
IGL02240:Glis3 APN 19 28531525 missense probably damaging 1.00
IGL02347:Glis3 APN 19 28531883 missense probably benign
IGL02904:Glis3 APN 19 28357952 missense possibly damaging 0.58
glee UTSW 19 28262677 utr 3 prime probably benign
R0071:Glis3 UTSW 19 28263855 splice site probably benign
R0071:Glis3 UTSW 19 28263855 splice site probably benign
R0106:Glis3 UTSW 19 28531868 missense possibly damaging 0.67
R0106:Glis3 UTSW 19 28531868 missense possibly damaging 0.67
R0399:Glis3 UTSW 19 28298768 splice site probably benign
R1462:Glis3 UTSW 19 28262518 utr 3 prime probably benign
R1901:Glis3 UTSW 19 28531585 missense probably damaging 1.00
R1976:Glis3 UTSW 19 28262677 utr 3 prime probably benign
R1982:Glis3 UTSW 19 28531274 missense probably damaging 1.00
R2155:Glis3 UTSW 19 28531302 missense probably benign 0.16
R3723:Glis3 UTSW 19 28262591 nonsense probably null
R4496:Glis3 UTSW 19 28666127 missense possibly damaging 0.90
R4921:Glis3 UTSW 19 28666104 missense probably damaging 1.00
R5088:Glis3 UTSW 19 28531579 missense probably benign 0.00
R5241:Glis3 UTSW 19 28350023 missense probably benign 0.02
R5557:Glis3 UTSW 19 28264009 missense probably benign 0.00
R6226:Glis3 UTSW 19 28317302 missense probably damaging 1.00
R6309:Glis3 UTSW 19 28317361 missense probably benign 0.24
R6488:Glis3 UTSW 19 28298853 missense probably benign 0.13
R7069:Glis3 UTSW 19 28531519 missense probably damaging 1.00
R7260:Glis3 UTSW 19 28531402 missense probably benign
R7313:Glis3 UTSW 19 28531019 missense probably damaging 1.00
R7320:Glis3 UTSW 19 28531598 missense probably damaging 1.00
R7767:Glis3 UTSW 19 28263960 missense probably benign 0.18
R7839:Glis3 UTSW 19 28317373 missense possibly damaging 0.81
R7922:Glis3 UTSW 19 28317373 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCCCCTTGCACCAGTTAGAGGAAG -3'
(R):5'- AAGCACTGCTGCCGTTGGATAG -3'

Sequencing Primer
(F):5'- GTACCTTGACCATCACACATCC -3'
(R):5'- CTGCCGTTGGATAGACTGC -3'
Posted On2013-09-03