Incidental Mutation 'R8816:Trio'
ID 672763
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Name triple functional domain (PTPRF interacting)
Synonyms Solo, 6720464I07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8816 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 27730651-28025848 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 27741271 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 2680 (N2680K)
Ref Sequence ENSEMBL: ENSMUSP00000087714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000090247
AA Change: N2680K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: N2680K

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000227030
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,236,687 H348L probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Ass1 T C 2: 31,493,177 probably benign Het
Atp8b4 C T 2: 126,372,164 probably benign Het
Atrn C A 2: 130,906,878 N106K probably damaging Het
Atrn T C 2: 131,004,574 V1256A probably damaging Het
Bicdl1 T A 5: 115,724,745 Q150H probably damaging Het
Cdhr4 T C 9: 107,995,592 V280A possibly damaging Het
Cfap54 C T 10: 92,878,592 V2642I unknown Het
Chd2 T C 7: 73,490,497 H661R probably damaging Het
Cntnap2 A G 6: 46,856,142 D763G possibly damaging Het
Csnk1g2 T C 10: 80,638,259 C160R probably damaging Het
Cyb5r4 T C 9: 87,022,233 S19P probably benign Het
Cyp4a30b G A 4: 115,452,637 V12M probably benign Het
Dpp6 C T 5: 27,725,713 P848S probably benign Het
Dzip1 T C 14: 118,922,373 Y141C probably benign Het
Eif2b3 C A 4: 117,070,855 Q424K probably benign Het
Fbxw14 G A 9: 109,276,237 R287* probably null Het
Fcgbp T G 7: 28,084,987 S157R probably benign Het
Fmnl2 T G 2: 53,114,202 V642G unknown Het
Gpr119 C T X: 48,673,399 R287Q possibly damaging Het
Grm7 C T 6: 111,254,005 T463I possibly damaging Het
Haus4 G A 14: 54,542,253 R305C probably benign Het
Htr1f A G 16: 64,926,174 S252P probably benign Het
Ino80b T C 6: 83,121,880 Q359R probably damaging Het
Itgad C A 7: 128,198,370 Y924* probably null Het
Itpr2 A G 6: 146,241,212 Y1703H probably damaging Het
Kif5c T A 2: 49,694,787 V174E probably damaging Het
Kifc2 A G 15: 76,664,171 E405G probably damaging Het
Klk1b3 T C 7: 44,202,244 V242A possibly damaging Het
Kndc1 T C 7: 139,937,996 F1615S probably damaging Het
Lmtk2 T A 5: 144,175,975 L1171* probably null Het
Myh10 A G 11: 68,802,952 E1530G probably damaging Het
Nav3 T A 10: 109,863,860 S258C possibly damaging Het
Nudcd3 C T 11: 6,150,587 G186S probably damaging Het
Olfr1411 T A 1: 92,597,046 C176S probably damaging Het
Otog C T 7: 46,301,481 S374F possibly damaging Het
P2ry2 T A 7: 100,998,556 I181F possibly damaging Het
Pde11a T C 2: 76,291,233 I335V probably benign Het
Phyhip A C 14: 70,466,935 D198A probably damaging Het
Pik3r5 A T 11: 68,494,234 Y655F probably damaging Het
Rab6a T C 7: 100,629,938 I95T possibly damaging Het
Sgsm1 T C 5: 113,287,231 E99G probably damaging Het
Skint10 A T 4: 112,746,695 F98L probably benign Het
Slc35c2 A G 2: 165,277,458 S321P probably benign Het
Smyd1 T A 6: 71,215,884 E447V probably damaging Het
Smyd4 T C 11: 75,390,406 V235A probably benign Het
Sod2 A G 17: 13,008,366 Y69C probably benign Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Tfap2b A G 1: 19,214,113 S82G probably benign Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Tln2 A G 9: 67,221,517 I1430T probably damaging Het
Trmt10c A T 16: 56,034,159 V371D probably damaging Het
Trpm3 T C 19: 22,988,216 S1692P probably damaging Het
Uhrf1bp1l T C 10: 89,790,735 probably benign Het
Usb1 G T 8: 95,345,356 C228F probably benign Het
Veph1 G T 3: 66,158,225 H474N probably benign Het
Wls A G 3: 159,934,292 T520A possibly damaging Het
Ywhae T C 11: 75,733,052 Y9H probably damaging Het
Zranb3 C T 1: 128,036,610 V127M possibly damaging Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27912743 splice site probably benign
IGL01011:Trio APN 15 27736489 missense probably damaging 0.96
IGL01090:Trio APN 15 27773007 missense probably damaging 1.00
IGL01145:Trio APN 15 27818167 splice site probably benign
IGL01147:Trio APN 15 27881320 missense probably damaging 1.00
IGL01161:Trio APN 15 27749781 missense probably damaging 1.00
IGL01324:Trio APN 15 27905323 missense probably benign 0.42
IGL01352:Trio APN 15 27901229 missense probably benign 0.01
IGL01366:Trio APN 15 27732868 missense possibly damaging 0.76
IGL01443:Trio APN 15 27838775 splice site probably benign
IGL01454:Trio APN 15 27832985 missense probably benign 0.32
IGL01695:Trio APN 15 27773001 missense probably damaging 1.00
IGL01765:Trio APN 15 27764026 missense possibly damaging 0.85
IGL01860:Trio APN 15 27846810 missense probably damaging 1.00
IGL01879:Trio APN 15 27741033 missense probably benign 0.12
IGL01991:Trio APN 15 27871274 missense possibly damaging 0.95
IGL02106:Trio APN 15 27744158 missense possibly damaging 0.85
IGL02209:Trio APN 15 27744053 missense probably damaging 1.00
IGL02232:Trio APN 15 27902561 missense probably benign 0.24
IGL02304:Trio APN 15 27735436 missense probably damaging 0.96
IGL02504:Trio APN 15 27847390 nonsense probably null
IGL02508:Trio APN 15 27818104 missense possibly damaging 0.65
IGL02541:Trio APN 15 27844930 splice site probably benign
IGL02617:Trio APN 15 27841849 splice site probably benign
IGL02675:Trio APN 15 27768039 unclassified probably benign
IGL02817:Trio APN 15 27902881 missense probably benign 0.01
IGL02993:Trio APN 15 27830239 splice site probably benign
IGL03007:Trio APN 15 27902742 missense probably damaging 0.99
IGL03135:Trio APN 15 27832011 splice site probably benign
IGL03225:Trio APN 15 27902695 missense probably benign 0.30
R0063:Trio UTSW 15 27881437 splice site probably benign
R0063:Trio UTSW 15 27881437 splice site probably benign
R0302:Trio UTSW 15 27902517 missense probably damaging 1.00
R0505:Trio UTSW 15 27767907 missense probably benign 0.00
R0506:Trio UTSW 15 27854963 missense probably benign 0.12
R0564:Trio UTSW 15 27805822 missense probably damaging 1.00
R0659:Trio UTSW 15 27831399 missense probably damaging 0.97
R0882:Trio UTSW 15 27732894 missense probably damaging 1.00
R0939:Trio UTSW 15 27741250 critical splice donor site probably null
R1018:Trio UTSW 15 27871171 missense probably damaging 1.00
R1439:Trio UTSW 15 27897914 missense probably damaging 1.00
R1456:Trio UTSW 15 27753804 splice site probably benign
R1488:Trio UTSW 15 27740967 missense probably damaging 1.00
R1522:Trio UTSW 15 27732640 missense probably benign 0.28
R1531:Trio UTSW 15 27832985 missense probably benign 0.32
R1640:Trio UTSW 15 27833044 missense probably damaging 1.00
R1646:Trio UTSW 15 27758347 missense possibly damaging 0.91
R1682:Trio UTSW 15 27744146 splice site probably null
R1780:Trio UTSW 15 27744038 missense possibly damaging 0.93
R1791:Trio UTSW 15 27841756 missense probably damaging 1.00
R1803:Trio UTSW 15 27748340 missense probably benign
R1817:Trio UTSW 15 27742495 nonsense probably null
R1853:Trio UTSW 15 27756536 missense probably damaging 1.00
R1898:Trio UTSW 15 27742380 missense possibly damaging 0.52
R1937:Trio UTSW 15 27833056 missense probably damaging 1.00
R1938:Trio UTSW 15 27732891 missense probably damaging 0.98
R2025:Trio UTSW 15 27744137 missense probably damaging 0.99
R2025:Trio UTSW 15 27773927 missense probably damaging 1.00
R2050:Trio UTSW 15 27851945 missense possibly damaging 0.85
R2186:Trio UTSW 15 27823975 splice site probably null
R2913:Trio UTSW 15 27854912 missense probably damaging 1.00
R3151:Trio UTSW 15 27805776 missense probably damaging 1.00
R3771:Trio UTSW 15 27748091 missense probably damaging 0.98
R3773:Trio UTSW 15 27748091 missense probably damaging 0.98
R3826:Trio UTSW 15 27833070 missense probably damaging 1.00
R4015:Trio UTSW 15 27744101 missense possibly damaging 0.71
R4359:Trio UTSW 15 27749797 nonsense probably null
R4370:Trio UTSW 15 27748337 nonsense probably null
R4547:Trio UTSW 15 27818982 missense possibly damaging 0.89
R4573:Trio UTSW 15 27772998 small deletion probably benign
R4620:Trio UTSW 15 27871171 missense probably damaging 1.00
R4735:Trio UTSW 15 27752789 splice site probably null
R4764:Trio UTSW 15 27732538 nonsense probably null
R4775:Trio UTSW 15 27881342 nonsense probably null
R4942:Trio UTSW 15 27752725 missense probably benign 0.21
R5004:Trio UTSW 15 27755178 missense probably damaging 1.00
R5149:Trio UTSW 15 27754029 missense possibly damaging 0.74
R5183:Trio UTSW 15 27902600 missense probably benign 0.00
R5186:Trio UTSW 15 27897991 missense probably damaging 0.97
R5268:Trio UTSW 15 27748286 missense probably benign 0.02
R5344:Trio UTSW 15 27735532 missense probably benign 0.12
R5407:Trio UTSW 15 27844806 splice site probably null
R5442:Trio UTSW 15 27856194 missense probably benign 0.04
R5617:Trio UTSW 15 27902748 missense probably benign
R5778:Trio UTSW 15 27856164 missense probably benign 0.33
R5986:Trio UTSW 15 27851933 missense possibly damaging 0.88
R5990:Trio UTSW 15 27891459 missense probably benign 0.10
R6011:Trio UTSW 15 27735545 missense probably damaging 0.98
R6063:Trio UTSW 15 27891379 missense possibly damaging 0.94
R6166:Trio UTSW 15 27818071 missense probably damaging 0.96
R6187:Trio UTSW 15 27743952 critical splice donor site probably null
R6387:Trio UTSW 15 27752739 missense probably damaging 1.00
R6402:Trio UTSW 15 27902911 missense probably benign 0.02
R6478:Trio UTSW 15 27856107 missense probably benign 0.01
R6528:Trio UTSW 15 27805870 missense probably damaging 1.00
R6662:Trio UTSW 15 27854996 missense probably benign 0.00
R6825:Trio UTSW 15 27889308 missense probably damaging 0.98
R6890:Trio UTSW 15 27919288 unclassified probably benign
R6945:Trio UTSW 15 27824090 missense probably damaging 1.00
R7027:Trio UTSW 15 27805654 missense possibly damaging 0.86
R7046:Trio UTSW 15 27832051 missense probably damaging 1.00
R7049:Trio UTSW 15 27749799 missense possibly damaging 0.66
R7075:Trio UTSW 15 27898000 missense unknown
R7094:Trio UTSW 15 27891448 missense unknown
R7123:Trio UTSW 15 27742313 critical splice donor site probably benign
R7130:Trio UTSW 15 27742313 critical splice donor site probably benign
R7214:Trio UTSW 15 27871187 missense probably damaging 0.97
R7292:Trio UTSW 15 27828351 missense possibly damaging 0.63
R7293:Trio UTSW 15 27871289 missense possibly damaging 0.66
R7352:Trio UTSW 15 27732876 missense probably damaging 0.96
R7426:Trio UTSW 15 27856107 missense probably benign 0.01
R7451:Trio UTSW 15 27747913 missense probably benign 0.07
R7558:Trio UTSW 15 27831394 missense possibly damaging 0.90
R7578:Trio UTSW 15 27854939 missense possibly damaging 0.94
R7596:Trio UTSW 15 27749826 missense probably damaging 0.99
R7604:Trio UTSW 15 27736445 critical splice donor site probably null
R7609:Trio UTSW 15 27912642 missense unknown
R7767:Trio UTSW 15 27889418 missense unknown
R7784:Trio UTSW 15 27763994 missense probably damaging 1.00
R7817:Trio UTSW 15 27749866 missense probably benign 0.35
R7833:Trio UTSW 15 27774086 missense probably damaging 0.99
R7873:Trio UTSW 15 27805684 missense possibly damaging 0.83
R7879:Trio UTSW 15 27851924 missense possibly damaging 0.94
R7989:Trio UTSW 15 27772935 missense probably damaging 0.97
R8022:Trio UTSW 15 27749866 missense probably benign 0.35
R8050:Trio UTSW 15 27891454 missense unknown
R8217:Trio UTSW 15 27818969 missense probably damaging 0.97
R8280:Trio UTSW 15 27902910 missense unknown
R8283:Trio UTSW 15 27756542 missense possibly damaging 0.79
R8300:Trio UTSW 15 27855022 missense possibly damaging 0.66
R8321:Trio UTSW 15 27881326 missense possibly damaging 0.90
R8477:Trio UTSW 15 27773952 missense possibly damaging 0.83
R8479:Trio UTSW 15 27901200 missense probably benign 0.25
R8682:Trio UTSW 15 27905192 missense unknown
R8688:Trio UTSW 15 27748238 missense possibly damaging 0.61
R8708:Trio UTSW 15 27732546 missense probably damaging 0.99
R8709:Trio UTSW 15 27919237 missense unknown
R8713:Trio UTSW 15 27743951 critical splice donor site probably benign
R8798:Trio UTSW 15 27851837 missense possibly damaging 0.92
R8812:Trio UTSW 15 27905225 missense unknown
R8828:Trio UTSW 15 27741064 missense possibly damaging 0.93
R8987:Trio UTSW 15 27732687 missense probably benign 0.23
R9051:Trio UTSW 15 27732684 missense possibly damaging 0.78
R9069:Trio UTSW 15 27852011 missense possibly damaging 0.83
R9075:Trio UTSW 15 27773936 nonsense probably null
R9079:Trio UTSW 15 27732937 missense possibly damaging 0.52
R9139:Trio UTSW 15 27749836 nonsense probably null
X0024:Trio UTSW 15 27765726 missense possibly damaging 0.91
Z1176:Trio UTSW 15 27771387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGTCAATGCCAGTCACCCTTC -3'
(R):5'- AGCGTGTTTGTGAATAAGAAGC -3'

Sequencing Primer
(F):5'- CTCTCTCATGGGCTCCTTCAAAATC -3'
(R):5'- GTTTGTGAATAAGAAGCTAAGCCTCG -3'
Posted On 2021-04-30