Incidental Mutation 'R8816:Htr1f'
ID672766
Institutional Source Beutler Lab
Gene Symbol Htr1f
Ensembl Gene ENSMUSG00000050783
Gene Name5-hydroxytryptamine (serotonin) receptor 1F
SynonymsHtr1eb
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8816 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location64924729-65105854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64926174 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 252 (S252P)
Ref Sequence ENSEMBL: ENSMUSP00000063136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063076]
Predicted Effect probably benign
Transcript: ENSMUST00000063076
AA Change: S252P

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000063136
Gene: ENSMUSG00000050783
AA Change: S252P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 32 230 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 34 362 2.4e-10 PFAM
Pfam:7tm_1 40 347 4.1e-74 PFAM
Pfam:7TM_GPCR_Srv 54 249 5.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display decreased temperature sensitivity and physiological abnormalities in nerve fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,236,687 H348L probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Ass1 T C 2: 31,493,177 probably benign Het
Atp8b4 C T 2: 126,372,164 probably benign Het
Atrn C A 2: 130,906,878 N106K probably damaging Het
Atrn T C 2: 131,004,574 V1256A probably damaging Het
Bicdl1 T A 5: 115,724,745 Q150H probably damaging Het
Cdhr4 T C 9: 107,995,592 V280A possibly damaging Het
Cfap54 C T 10: 92,878,592 V2642I unknown Het
Chd2 T C 7: 73,490,497 H661R probably damaging Het
Cntnap2 A G 6: 46,856,142 D763G possibly damaging Het
Csnk1g2 T C 10: 80,638,259 C160R probably damaging Het
Cyb5r4 T C 9: 87,022,233 S19P probably benign Het
Cyp4a30b G A 4: 115,452,637 V12M probably benign Het
Dpp6 C T 5: 27,725,713 P848S probably benign Het
Dzip1 T C 14: 118,922,373 Y141C probably benign Het
Eif2b3 C A 4: 117,070,855 Q424K probably benign Het
Fbxw14 G A 9: 109,276,237 R287* probably null Het
Fcgbp T G 7: 28,084,987 S157R probably benign Het
Fmnl2 T G 2: 53,114,202 V642G unknown Het
Gpr119 C T X: 48,673,399 R287Q possibly damaging Het
Grm7 C T 6: 111,254,005 T463I possibly damaging Het
Haus4 G A 14: 54,542,253 R305C probably benign Het
Ino80b T C 6: 83,121,880 Q359R probably damaging Het
Itgad C A 7: 128,198,370 Y924* probably null Het
Itpr2 A G 6: 146,241,212 Y1703H probably damaging Het
Kif5c T A 2: 49,694,787 V174E probably damaging Het
Kifc2 A G 15: 76,664,171 E405G probably damaging Het
Klk1b3 T C 7: 44,202,244 V242A possibly damaging Het
Kndc1 T C 7: 139,937,996 F1615S probably damaging Het
Lmtk2 T A 5: 144,175,975 L1171* probably null Het
Myh10 A G 11: 68,802,952 E1530G probably damaging Het
Nav3 T A 10: 109,863,860 S258C possibly damaging Het
Nudcd3 C T 11: 6,150,587 G186S probably damaging Het
Olfr1411 T A 1: 92,597,046 C176S probably damaging Het
Otog C T 7: 46,301,481 S374F possibly damaging Het
P2ry2 T A 7: 100,998,556 I181F possibly damaging Het
Pde11a T C 2: 76,291,233 I335V probably benign Het
Phyhip A C 14: 70,466,935 D198A probably damaging Het
Pik3r5 A T 11: 68,494,234 Y655F probably damaging Het
Rab6a T C 7: 100,629,938 I95T possibly damaging Het
Sgsm1 T C 5: 113,287,231 E99G probably damaging Het
Skint10 A T 4: 112,746,695 F98L probably benign Het
Slc35c2 A G 2: 165,277,458 S321P probably benign Het
Smyd1 T A 6: 71,215,884 E447V probably damaging Het
Smyd4 T C 11: 75,390,406 V235A probably benign Het
Sod2 A G 17: 13,008,366 Y69C probably benign Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Tfap2b A G 1: 19,214,113 S82G probably benign Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Tln2 A G 9: 67,221,517 I1430T probably damaging Het
Trio G T 15: 27,741,271 N2680K probably damaging Het
Trmt10c A T 16: 56,034,159 V371D probably damaging Het
Trpm3 T C 19: 22,988,216 S1692P probably damaging Het
Uhrf1bp1l T C 10: 89,790,735 probably benign Het
Usb1 G T 8: 95,345,356 C228F probably benign Het
Veph1 G T 3: 66,158,225 H474N probably benign Het
Wls A G 3: 159,934,292 T520A possibly damaging Het
Ywhae T C 11: 75,733,052 Y9H probably damaging Het
Zranb3 C T 1: 128,036,610 V127M possibly damaging Het
Other mutations in Htr1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Htr1f APN 16 64926106 missense probably benign 0.00
IGL01134:Htr1f APN 16 64926138 missense probably benign 0.00
IGL01455:Htr1f APN 16 64926022 missense probably damaging 1.00
IGL01580:Htr1f APN 16 64925835 nonsense probably null
IGL01865:Htr1f APN 16 64925919 missense probably damaging 1.00
IGL02027:Htr1f APN 16 64926321 nonsense probably null
IGL02234:Htr1f APN 16 64926067 missense probably damaging 1.00
IGL02567:Htr1f APN 16 64926248 missense probably benign 0.45
R0035:Htr1f UTSW 16 64926497 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0132:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0193:Htr1f UTSW 16 64926749 missense probably damaging 1.00
R0523:Htr1f UTSW 16 64925899 missense probably damaging 1.00
R0722:Htr1f UTSW 16 64925891 missense probably damaging 0.99
R2055:Htr1f UTSW 16 64926035 missense probably damaging 1.00
R3418:Htr1f UTSW 16 64925897 missense probably damaging 1.00
R4090:Htr1f UTSW 16 64925961 missense probably benign 0.06
R4320:Htr1f UTSW 16 64926687 missense possibly damaging 0.87
R5037:Htr1f UTSW 16 64925928 missense probably damaging 1.00
R6004:Htr1f UTSW 16 64925876 missense probably damaging 1.00
R7383:Htr1f UTSW 16 64926843 missense probably benign 0.00
R7462:Htr1f UTSW 16 64926020 missense probably damaging 0.99
R7864:Htr1f UTSW 16 64926794 missense probably damaging 1.00
R8677:Htr1f UTSW 16 64926051 missense possibly damaging 0.69
R8836:Htr1f UTSW 16 64926833 missense probably benign
Z1176:Htr1f UTSW 16 64926077 nonsense probably null
Z1176:Htr1f UTSW 16 64926874 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCAGCCAACATATTACAAATG -3'
(R):5'- ACTAGCCGTGATGATGAGTG -3'

Sequencing Primer
(F):5'- TGCACCCAAGATCAATCCCAGG -3'
(R):5'- TCAAACATGACCACATTGTTTCC -3'
Posted On2021-04-30