Incidental Mutation 'R8817:Zfp282'
ID 672795
Institutional Source Beutler Lab
Gene Symbol Zfp282
Ensembl Gene ENSMUSG00000025821
Gene Name zinc finger protein 282
Synonyms HUB1
MMRRC Submission 068727-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R8817 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 47854138-47885419 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 47881760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 482 (N482K)
Ref Sequence ENSEMBL: ENSMUSP00000053643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061890]
AlphaFold E9PVC2
Predicted Effect probably benign
Transcript: ENSMUST00000061890
AA Change: N482K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000053643
Gene: ENSMUSG00000025821
AA Change: N482K

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Pfam:DUF3669 98 168 1.8e-12 PFAM
KRAB 198 260 1.04e-21 SMART
internal_repeat_1 317 372 1.1e-13 PROSPERO
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 457 499 N/A INTRINSIC
ZnF_C2H2 514 536 8.94e-3 SMART
ZnF_C2H2 542 564 4.72e-2 SMART
ZnF_C2H2 570 592 1.04e-3 SMART
ZnF_C2H2 598 620 4.24e-4 SMART
ZnF_C2H2 626 648 1.06e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A G 4: 144,400,361 (GRCm39) V139A probably benign Het
Aass A T 6: 23,097,195 (GRCm39) Y41* probably null Het
AI429214 G A 8: 37,461,268 (GRCm39) V139I probably benign Het
Cacna1a G A 8: 85,365,426 (GRCm39) A2190T probably benign Het
Cstpp1 A G 2: 91,107,343 (GRCm39) Y320H probably benign Het
Cutc T C 19: 43,744,113 (GRCm39) V38A probably benign Het
Cxcl10 G T 5: 92,495,230 (GRCm39) P98H probably damaging Het
Dop1a T C 9: 86,396,003 (GRCm39) S822P possibly damaging Het
Dusp19 T C 2: 80,454,631 (GRCm39) L117P probably damaging Het
Emc3 A G 6: 113,492,868 (GRCm39) F261S probably damaging Het
Ephx2 T C 14: 66,344,725 (GRCm39) T200A probably benign Het
Eri1 A C 8: 35,945,792 (GRCm39) D164E probably damaging Het
Ethe1 T C 7: 24,305,727 (GRCm39) I158T probably damaging Het
Fancm C T 12: 65,167,331 (GRCm39) R1547C probably damaging Het
Fer1l4 T A 2: 155,890,143 (GRCm39) T261S probably damaging Het
Fyb2 A G 4: 104,802,652 (GRCm39) R185G probably benign Het
Gabrp A T 11: 33,504,464 (GRCm39) S284T possibly damaging Het
Gga2 G A 7: 121,590,845 (GRCm39) R488* probably null Het
Gm9758 A G 5: 14,962,230 (GRCm39) L126S probably damaging Het
Gse1 T C 8: 121,294,542 (GRCm39) F290L probably damaging Het
Hdgfl1 A G 13: 26,954,068 (GRCm39) S2P probably damaging Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Huwe1 A G X: 150,669,993 (GRCm39) K1482R probably benign Het
Lama2 A T 10: 27,063,869 (GRCm39) W1307R probably damaging Het
Map3k6 A G 4: 132,974,071 (GRCm39) K517E probably benign Het
Mbl1 T A 14: 40,875,555 (GRCm39) L3Q unknown Het
Mepe G T 5: 104,485,151 (GRCm39) R97L probably benign Het
Minpp1 T A 19: 32,463,747 (GRCm39) M136K possibly damaging Het
Mrgprb1 T A 7: 48,097,070 (GRCm39) I281F probably benign Het
Naip5 T C 13: 100,349,207 (GRCm39) I1374V probably benign Het
Or14j8 A G 17: 38,263,273 (GRCm39) I214T probably damaging Het
Or4c12 A G 2: 89,773,790 (GRCm39) L223S probably damaging Het
Or52e19b A T 7: 103,032,825 (GRCm39) I128N probably damaging Het
Or8g34 C T 9: 39,373,387 (GRCm39) S217F probably damaging Het
Or8g37 G T 9: 39,730,939 (GRCm39) M1I probably null Het
Pamr1 T G 2: 102,464,766 (GRCm39) V305G probably benign Het
Pcbp3 T C 10: 76,625,670 (GRCm39) T125A probably benign Het
Peli2 G A 14: 48,490,130 (GRCm39) E201K possibly damaging Het
Pitpnm3 T C 11: 71,941,894 (GRCm39) E971G possibly damaging Het
Pkdrej A G 15: 85,702,774 (GRCm39) V1054A probably damaging Het
Plcb1 G A 2: 135,175,429 (GRCm39) probably benign Het
Prpf40a T C 2: 53,042,971 (GRCm39) K480E probably damaging Het
Psd3 A G 8: 68,413,135 (GRCm39) I465T possibly damaging Het
Pskh1 C T 8: 106,656,352 (GRCm39) R343W probably damaging Het
Ptprz1 A T 6: 23,007,371 (GRCm39) T1645S probably damaging Het
Rasal1 T C 5: 120,808,416 (GRCm39) F483L probably damaging Het
Rbm28 T C 6: 29,155,023 (GRCm39) probably benign Het
Recql G A 6: 142,304,612 (GRCm39) probably benign Het
Rnf40 T C 7: 127,196,332 (GRCm39) V760A probably damaging Het
Rp1l1 A T 14: 64,268,085 (GRCm39) R1224W probably benign Het
Rpgrip1 T C 14: 52,378,056 (GRCm39) V468A probably benign Het
Ryr2 T A 13: 11,750,509 (GRCm39) I1921F possibly damaging Het
Sirpa G A 2: 129,435,558 (GRCm39) G9D unknown Het
Slc28a2b A T 2: 122,348,988 (GRCm39) T305S possibly damaging Het
Slc40a1 A C 1: 45,948,699 (GRCm39) V527G probably damaging Het
Smarca4 T A 9: 21,547,497 (GRCm39) M260K probably benign Het
Smarca5 A T 8: 81,460,379 (GRCm39) M119K probably benign Het
Smg1 A G 7: 117,758,887 (GRCm39) V2206A unknown Het
Sp4 A T 12: 118,225,624 (GRCm39) V580D possibly damaging Het
Spata31d1c G A 13: 65,182,376 (GRCm39) C75Y probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Srcap T C 7: 127,152,395 (GRCm39) S2220P probably benign Het
Stra6 G T 9: 58,059,265 (GRCm39) V543F possibly damaging Het
Tenm4 T A 7: 96,523,335 (GRCm39) F1626I probably benign Het
Tjp1 T C 7: 64,952,810 (GRCm39) N1508S probably benign Het
Trrap T A 5: 144,782,348 (GRCm39) L3298Q probably damaging Het
Tsn A G 1: 118,232,470 (GRCm39) L135P probably damaging Het
Ttl A T 2: 128,910,778 (GRCm39) H54L probably damaging Het
Ttn T A 2: 76,660,251 (GRCm39) T12110S unknown Het
Uba6 T C 5: 86,296,772 (GRCm39) I306V probably null Het
Ubap2 A G 4: 41,223,425 (GRCm39) S204P possibly damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Ush2a A T 1: 187,995,231 (GRCm39) M1L probably benign Het
Vmn1r159 C A 7: 22,542,559 (GRCm39) V158F probably benign Het
Wif1 A G 10: 120,932,621 (GRCm39) H333R possibly damaging Het
Other mutations in Zfp282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Zfp282 APN 6 47,857,324 (GRCm39) missense probably damaging 1.00
IGL00755:Zfp282 APN 6 47,857,324 (GRCm39) missense probably damaging 1.00
IGL01402:Zfp282 APN 6 47,874,770 (GRCm39) missense probably damaging 0.99
IGL01404:Zfp282 APN 6 47,874,770 (GRCm39) missense probably damaging 0.99
IGL01484:Zfp282 APN 6 47,867,054 (GRCm39) missense possibly damaging 0.76
IGL01560:Zfp282 APN 6 47,857,211 (GRCm39) missense probably damaging 1.00
IGL02949:Zfp282 APN 6 47,874,848 (GRCm39) missense probably damaging 1.00
FR4304:Zfp282 UTSW 6 47,881,731 (GRCm39) small insertion probably benign
FR4589:Zfp282 UTSW 6 47,881,725 (GRCm39) small insertion probably benign
FR4737:Zfp282 UTSW 6 47,881,733 (GRCm39) small insertion probably benign
FR4737:Zfp282 UTSW 6 47,881,724 (GRCm39) small insertion probably benign
FR4976:Zfp282 UTSW 6 47,881,724 (GRCm39) small insertion probably benign
R0020:Zfp282 UTSW 6 47,856,943 (GRCm39) missense probably damaging 1.00
R0020:Zfp282 UTSW 6 47,856,943 (GRCm39) missense probably damaging 1.00
R0118:Zfp282 UTSW 6 47,869,866 (GRCm39) missense probably benign 0.34
R0415:Zfp282 UTSW 6 47,881,987 (GRCm39) missense possibly damaging 0.88
R0415:Zfp282 UTSW 6 47,874,815 (GRCm39) missense probably damaging 0.99
R0607:Zfp282 UTSW 6 47,857,303 (GRCm39) missense probably damaging 1.00
R0710:Zfp282 UTSW 6 47,857,318 (GRCm39) missense probably damaging 1.00
R0946:Zfp282 UTSW 6 47,856,943 (GRCm39) missense probably damaging 1.00
R1054:Zfp282 UTSW 6 47,881,533 (GRCm39) missense probably benign 0.00
R1401:Zfp282 UTSW 6 47,867,108 (GRCm39) nonsense probably null
R1572:Zfp282 UTSW 6 47,869,801 (GRCm39) missense probably damaging 1.00
R2016:Zfp282 UTSW 6 47,874,721 (GRCm39) splice site probably null
R2971:Zfp282 UTSW 6 47,874,866 (GRCm39) splice site probably null
R4064:Zfp282 UTSW 6 47,857,028 (GRCm39) missense probably damaging 0.99
R4478:Zfp282 UTSW 6 47,867,630 (GRCm39) nonsense probably null
R4530:Zfp282 UTSW 6 47,867,567 (GRCm39) missense probably benign 0.00
R4532:Zfp282 UTSW 6 47,867,567 (GRCm39) missense probably benign 0.00
R5068:Zfp282 UTSW 6 47,854,637 (GRCm39) missense probably benign 0.01
R5261:Zfp282 UTSW 6 47,874,824 (GRCm39) missense probably damaging 0.99
R5326:Zfp282 UTSW 6 47,882,261 (GRCm39) missense probably benign
R5551:Zfp282 UTSW 6 47,867,579 (GRCm39) missense possibly damaging 0.59
R6046:Zfp282 UTSW 6 47,857,102 (GRCm39) missense probably damaging 1.00
R6408:Zfp282 UTSW 6 47,857,319 (GRCm39) missense probably damaging 1.00
R7535:Zfp282 UTSW 6 47,881,878 (GRCm39) missense probably benign 0.03
R8098:Zfp282 UTSW 6 47,867,652 (GRCm39) missense probably benign 0.00
R8158:Zfp282 UTSW 6 47,867,626 (GRCm39) missense possibly damaging 0.61
R8304:Zfp282 UTSW 6 47,881,722 (GRCm39) small deletion probably benign
R8385:Zfp282 UTSW 6 47,882,023 (GRCm39) missense possibly damaging 0.88
R8543:Zfp282 UTSW 6 47,881,561 (GRCm39) missense probably benign 0.40
S24628:Zfp282 UTSW 6 47,881,987 (GRCm39) missense possibly damaging 0.88
S24628:Zfp282 UTSW 6 47,874,815 (GRCm39) missense probably damaging 0.99
Z1177:Zfp282 UTSW 6 47,867,571 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCTCATCAGCAGAGCCTG -3'
(R):5'- GGCAGTTGAAGCTCTTCTCG -3'

Sequencing Primer
(F):5'- AGAGCCTGCCCGCCTTG -3'
(R):5'- ACTCTGCGCACTCGTATGG -3'
Posted On 2021-04-30