Incidental Mutation 'R8817:Mrgprb1'
ID 672799
Institutional Source Beutler Lab
Gene Symbol Mrgprb1
Ensembl Gene ENSMUSG00000070547
Gene Name MAS-related GPR, member B1
Synonyms MrgB1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R8817 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 48444113-48456342 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48447322 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 281 (I281F)
Ref Sequence ENSEMBL: ENSMUSP00000091946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094384] [ENSMUST00000188095] [ENSMUST00000188918]
AlphaFold Q3UG61
Predicted Effect probably benign
Transcript: ENSMUST00000094384
AA Change: I281F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000091946
Gene: ENSMUSG00000070547
AA Change: I281F

Pfam:7TM_GPCR_Srx 50 227 5.5e-11 PFAM
Pfam:7tm_1 59 290 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188095
Predicted Effect probably benign
Transcript: ENSMUST00000188918
SMART Domains Protein: ENSMUSP00000140432
Gene: ENSMUSG00000070547

SCOP:d1l9ha_ 23 84 3e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,276,998 Y320H probably benign Het
Aass A T 6: 23,097,196 Y41* probably null Het
AI429214 G A 8: 36,994,114 V139I probably benign Het
Cacna1a G A 8: 84,638,797 A2190T probably benign Het
Cutc T C 19: 43,755,674 V38A probably benign Het
Cxcl10 G T 5: 92,347,371 P98H probably damaging Het
Dopey1 T C 9: 86,513,950 S822P possibly damaging Het
Dusp19 T C 2: 80,624,287 L117P probably damaging Het
Emc3 A G 6: 113,515,907 F261S probably damaging Het
Ephx2 T C 14: 66,107,276 T200A probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
Ethe1 T C 7: 24,606,302 I158T probably damaging Het
Fancm C T 12: 65,120,557 R1547C probably damaging Het
Fer1l4 T A 2: 156,048,223 T261S probably damaging Het
Fyb2 A G 4: 104,945,455 R185G probably benign Het
Gabrp A T 11: 33,554,464 S284T possibly damaging Het
Gga2 G A 7: 121,991,622 R488* probably null Het
Gm14085 A T 2: 122,518,507 T305S possibly damaging Het
Gm436 A G 4: 144,673,791 V139A probably benign Het
Gm9758 A G 5: 14,912,216 L126S probably damaging Het
Gse1 T C 8: 120,567,803 F290L probably damaging Het
Hdgfl1 A G 13: 26,770,085 S2P probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Huwe1 A G X: 151,886,997 K1482R probably benign Het
Lama2 A T 10: 27,187,873 W1307R probably damaging Het
Map3k6 A G 4: 133,246,760 K517E probably benign Het
Mbl1 T A 14: 41,153,598 L3Q unknown Het
Mepe G T 5: 104,337,285 R97L probably benign Het
Minpp1 T A 19: 32,486,347 M136K possibly damaging Het
Naip5 T C 13: 100,212,699 I1374V probably benign Het
Olfr1259 A G 2: 89,943,446 L223S probably damaging Het
Olfr603 A T 7: 103,383,618 I128N probably damaging Het
Olfr761 A G 17: 37,952,382 I214T probably damaging Het
Olfr954 C T 9: 39,462,091 S217F probably damaging Het
Olfr970 G T 9: 39,819,643 M1I probably null Het
Pamr1 T G 2: 102,634,421 V305G probably benign Het
Pcbp3 T C 10: 76,789,836 T125A probably benign Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Pitpnm3 T C 11: 72,051,068 E971G possibly damaging Het
Pkdrej A G 15: 85,818,573 V1054A probably damaging Het
Plcb1 G A 2: 135,333,509 probably benign Het
Prpf40a T C 2: 53,152,959 K480E probably damaging Het
Psd3 A G 8: 67,960,483 I465T possibly damaging Het
Pskh1 C T 8: 105,929,720 R343W probably damaging Het
Ptprz1 A T 6: 23,007,372 T1645S probably damaging Het
Rasal1 T C 5: 120,670,351 F483L probably damaging Het
Rbm28 T C 6: 29,155,024 probably benign Het
Recql G A 6: 142,358,886 probably benign Het
Rnf40 T C 7: 127,597,160 V760A probably damaging Het
Rp1l1 A T 14: 64,030,636 R1224W probably benign Het
Rpgrip1 T C 14: 52,140,599 V468A probably benign Het
Ryr2 T A 13: 11,735,623 I1921F possibly damaging Het
Sirpa G A 2: 129,593,638 G9D unknown Het
Slc40a1 A C 1: 45,909,539 V527G probably damaging Het
Smarca4 T A 9: 21,636,201 M260K probably benign Het
Smarca5 A T 8: 80,733,750 M119K probably benign Het
Smg1 A G 7: 118,159,664 V2206A unknown Het
Sp4 A T 12: 118,261,889 V580D possibly damaging Het
Spata31d1c G A 13: 65,034,562 C75Y probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Srcap T C 7: 127,553,223 S2220P probably benign Het
Stra6 G T 9: 58,151,982 V543F possibly damaging Het
Tenm4 T A 7: 96,874,128 F1626I probably benign Het
Tjp1 T C 7: 65,303,062 N1508S probably benign Het
Trrap T A 5: 144,845,538 L3298Q probably damaging Het
Tsn A G 1: 118,304,740 L135P probably damaging Het
Ttl A T 2: 129,068,858 H54L probably damaging Het
Ttn T A 2: 76,829,907 T12110S unknown Het
Uba6 T C 5: 86,148,913 I306V probably null Het
Ubap2 A G 4: 41,223,425 S204P possibly damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Ush2a A T 1: 188,263,034 M1L probably benign Het
Vmn1r159 C A 7: 22,843,134 V158F probably benign Het
Wif1 A G 10: 121,096,716 H333R possibly damaging Het
Zfp282 T A 6: 47,904,826 N482K probably benign Het
Other mutations in Mrgprb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Mrgprb1 APN 7 48447543 missense probably damaging 0.99
IGL01141:Mrgprb1 APN 7 48448027 missense probably benign 0.36
IGL01393:Mrgprb1 APN 7 48448006 missense possibly damaging 0.48
IGL02430:Mrgprb1 APN 7 48447661 missense possibly damaging 0.95
IGL02485:Mrgprb1 APN 7 48447717 missense possibly damaging 0.88
R0026:Mrgprb1 UTSW 7 48447204 missense possibly damaging 0.66
R0051:Mrgprb1 UTSW 7 48447214 missense probably benign 0.01
R0789:Mrgprb1 UTSW 7 48456184 splice site probably benign
R1223:Mrgprb1 UTSW 7 48447687 missense possibly damaging 0.61
R1327:Mrgprb1 UTSW 7 48447429 missense possibly damaging 0.87
R1456:Mrgprb1 UTSW 7 48448029 missense probably damaging 0.98
R1561:Mrgprb1 UTSW 7 48447125 splice site probably null
R1567:Mrgprb1 UTSW 7 48447453 missense probably damaging 0.97
R2030:Mrgprb1 UTSW 7 48447328 missense possibly damaging 0.83
R2165:Mrgprb1 UTSW 7 48447322 missense probably benign 0.00
R2885:Mrgprb1 UTSW 7 48447721 missense probably damaging 1.00
R3108:Mrgprb1 UTSW 7 48447328 missense possibly damaging 0.93
R3919:Mrgprb1 UTSW 7 48448081 missense probably benign 0.03
R4021:Mrgprb1 UTSW 7 48447123 missense possibly damaging 0.95
R4613:Mrgprb1 UTSW 7 48447708 missense possibly damaging 0.91
R4809:Mrgprb1 UTSW 7 48447991 missense possibly damaging 0.89
R5249:Mrgprb1 UTSW 7 48447477 missense possibly damaging 0.91
R5425:Mrgprb1 UTSW 7 48447971 missense possibly damaging 0.81
R5555:Mrgprb1 UTSW 7 48447775 missense probably benign 0.06
R5595:Mrgprb1 UTSW 7 48447684 missense probably damaging 0.99
R5982:Mrgprb1 UTSW 7 48447820 missense probably benign 0.01
R6746:Mrgprb1 UTSW 7 48447897 missense possibly damaging 0.82
R7066:Mrgprb1 UTSW 7 48447676 missense probably benign 0.27
R7141:Mrgprb1 UTSW 7 48447687 missense possibly damaging 0.61
R7633:Mrgprb1 UTSW 7 48447583 missense probably benign 0.01
R8072:Mrgprb1 UTSW 7 48448147 nonsense probably null
R8080:Mrgprb1 UTSW 7 48446910 splice site probably null
R8112:Mrgprb1 UTSW 7 48447934 missense probably damaging 0.97
R8493:Mrgprb1 UTSW 7 48447573 missense probably damaging 0.99
R9135:Mrgprb1 UTSW 7 48447298 missense possibly damaging 0.95
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2021-04-30