Incidental Mutation 'R8817:Tenm4'
ID 672801
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Name teneurin transmembrane protein 4
Synonyms Doc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8817 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 96171246-96911093 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 96874128 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1626 (F1626I)
Ref Sequence ENSEMBL: ENSMUSP00000102783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000107162
AA Change: F1618I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: F1618I

Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107165
AA Change: F1626I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: F1626I

Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107166
AA Change: F1589I

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: F1589I

Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,276,998 Y320H probably benign Het
Aass A T 6: 23,097,196 Y41* probably null Het
AI429214 G A 8: 36,994,114 V139I probably benign Het
Cacna1a G A 8: 84,638,797 A2190T probably benign Het
Cutc T C 19: 43,755,674 V38A probably benign Het
Cxcl10 G T 5: 92,347,371 P98H probably damaging Het
Dopey1 T C 9: 86,513,950 S822P possibly damaging Het
Dusp19 T C 2: 80,624,287 L117P probably damaging Het
Emc3 A G 6: 113,515,907 F261S probably damaging Het
Ephx2 T C 14: 66,107,276 T200A probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
Ethe1 T C 7: 24,606,302 I158T probably damaging Het
Fancm C T 12: 65,120,557 R1547C probably damaging Het
Fer1l4 T A 2: 156,048,223 T261S probably damaging Het
Fyb2 A G 4: 104,945,455 R185G probably benign Het
Gabrp A T 11: 33,554,464 S284T possibly damaging Het
Gga2 G A 7: 121,991,622 R488* probably null Het
Gm14085 A T 2: 122,518,507 T305S possibly damaging Het
Gm436 A G 4: 144,673,791 V139A probably benign Het
Gm9758 A G 5: 14,912,216 L126S probably damaging Het
Gse1 T C 8: 120,567,803 F290L probably damaging Het
Hdgfl1 A G 13: 26,770,085 S2P probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Huwe1 A G X: 151,886,997 K1482R probably benign Het
Lama2 A T 10: 27,187,873 W1307R probably damaging Het
Map3k6 A G 4: 133,246,760 K517E probably benign Het
Mbl1 T A 14: 41,153,598 L3Q unknown Het
Mepe G T 5: 104,337,285 R97L probably benign Het
Minpp1 T A 19: 32,486,347 M136K possibly damaging Het
Mrgprb1 T A 7: 48,447,322 I281F probably benign Het
Naip5 T C 13: 100,212,699 I1374V probably benign Het
Olfr1259 A G 2: 89,943,446 L223S probably damaging Het
Olfr603 A T 7: 103,383,618 I128N probably damaging Het
Olfr761 A G 17: 37,952,382 I214T probably damaging Het
Olfr954 C T 9: 39,462,091 S217F probably damaging Het
Olfr970 G T 9: 39,819,643 M1I probably null Het
Pamr1 T G 2: 102,634,421 V305G probably benign Het
Pcbp3 T C 10: 76,789,836 T125A probably benign Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Pitpnm3 T C 11: 72,051,068 E971G possibly damaging Het
Pkdrej A G 15: 85,818,573 V1054A probably damaging Het
Plcb1 G A 2: 135,333,509 probably benign Het
Prpf40a T C 2: 53,152,959 K480E probably damaging Het
Psd3 A G 8: 67,960,483 I465T possibly damaging Het
Pskh1 C T 8: 105,929,720 R343W probably damaging Het
Ptprz1 A T 6: 23,007,372 T1645S probably damaging Het
Rasal1 T C 5: 120,670,351 F483L probably damaging Het
Rbm28 T C 6: 29,155,024 probably benign Het
Recql G A 6: 142,358,886 probably benign Het
Rnf40 T C 7: 127,597,160 V760A probably damaging Het
Rp1l1 A T 14: 64,030,636 R1224W probably benign Het
Rpgrip1 T C 14: 52,140,599 V468A probably benign Het
Ryr2 T A 13: 11,735,623 I1921F possibly damaging Het
Sirpa G A 2: 129,593,638 G9D unknown Het
Slc40a1 A C 1: 45,909,539 V527G probably damaging Het
Smarca4 T A 9: 21,636,201 M260K probably benign Het
Smarca5 A T 8: 80,733,750 M119K probably benign Het
Smg1 A G 7: 118,159,664 V2206A unknown Het
Sp4 A T 12: 118,261,889 V580D possibly damaging Het
Spata31d1c G A 13: 65,034,562 C75Y probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Srcap T C 7: 127,553,223 S2220P probably benign Het
Stra6 G T 9: 58,151,982 V543F possibly damaging Het
Tjp1 T C 7: 65,303,062 N1508S probably benign Het
Trrap T A 5: 144,845,538 L3298Q probably damaging Het
Tsn A G 1: 118,304,740 L135P probably damaging Het
Ttl A T 2: 129,068,858 H54L probably damaging Het
Ttn T A 2: 76,829,907 T12110S unknown Het
Uba6 T C 5: 86,148,913 I306V probably null Het
Ubap2 A G 4: 41,223,425 S204P possibly damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Ush2a A T 1: 188,263,034 M1L probably benign Het
Vmn1r159 C A 7: 22,843,134 V158F probably benign Het
Wif1 A G 10: 121,096,716 H333R possibly damaging Het
Zfp282 T A 6: 47,904,826 N482K probably benign Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96868009 missense probably benign 0.00
IGL00468:Tenm4 APN 7 96874472 missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96805138 splice site probably benign
IGL00979:Tenm4 APN 7 96729391 missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96874267 missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96729385 missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96895177 missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96874303 missense probably benign 0.00
IGL01579:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01587:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01625:Tenm4 APN 7 96885358 missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96553724 missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96885404 missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96896064 missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96895509 missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96895212 missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96553550 missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96895662 missense probably benign 0.40
IGL02207:Tenm4 APN 7 96874116 missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96823822 missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96854734 missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96704137 missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96874074 missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96774176 unclassified probably benign
IGL02656:Tenm4 APN 7 96885433 missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96896219 missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96894998 nonsense probably null
IGL02863:Tenm4 APN 7 96873706 missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96842968 missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96873762 missense probably damaging 1.00
principium UTSW 7 96797481 missense probably damaging 0.98
toccata UTSW 7 96902989 critical splice donor site probably null
P0026:Tenm4 UTSW 7 96874527 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96896052 missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96729340 splice site probably benign
R0277:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96772035 nonsense probably null
R0381:Tenm4 UTSW 7 96905881 missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96873766 missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96777851 missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96895623 missense probably benign 0.35
R0624:Tenm4 UTSW 7 96774020 missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96896275 splice site probably benign
R1037:Tenm4 UTSW 7 96797481 missense probably damaging 0.98
R1172:Tenm4 UTSW 7 96848044 missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96550051 missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96843048 missense probably benign 0.42
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96902989 critical splice donor site probably null
R1701:Tenm4 UTSW 7 96902889 missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96888685 missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96873780 missense probably benign 0.17
R1812:Tenm4 UTSW 7 96895940 missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96895326 missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96906290 missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96902847 missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96906009 missense probably benign 0.03
R2329:Tenm4 UTSW 7 96895862 missense probably benign 0.00
R2893:Tenm4 UTSW 7 96894990 missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96893125 splice site probably null
R3409:Tenm4 UTSW 7 96895160 missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3441:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3719:Tenm4 UTSW 7 96863563 missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96895772 missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4441:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4510:Tenm4 UTSW 7 96894863 missense probably benign
R4511:Tenm4 UTSW 7 96894863 missense probably benign
R4543:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4645:Tenm4 UTSW 7 96895742 missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96894924 missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96797484 missense probably damaging 0.99
R4784:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4880:Tenm4 UTSW 7 96905818 splice site probably null
R5036:Tenm4 UTSW 7 96694790 missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96852561 missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96895788 missense probably damaging 1.00
R5103:Tenm4 UTSW 7 96842957 missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96843149 missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96893086 missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96874203 missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96837331 missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96888827 missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96894680 missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96896209 nonsense probably null
R5590:Tenm4 UTSW 7 96797400 missense possibly damaging 0.73
R5590:Tenm4 UTSW 7 96797401 missense possibly damaging 0.93
R5597:Tenm4 UTSW 7 96553517 missense probably benign 0.00
R5782:Tenm4 UTSW 7 96893039 missense probably benign 0.00
R5861:Tenm4 UTSW 7 96843217 intron probably benign
R5890:Tenm4 UTSW 7 96902860 missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96854719 missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96845895 missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96522433 intron probably benign
R6060:Tenm4 UTSW 7 96873711 missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96837289 missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96874494 missense probably benign 0.33
R6333:Tenm4 UTSW 7 96774124 missense probably damaging 1.00
R6522:Tenm4 UTSW 7 96843044 missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6746:Tenm4 UTSW 7 96892860 missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96845712 missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96811959 missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6807:Tenm4 UTSW 7 96895271 missense probably damaging 1.00
R6809:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6810:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6811:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6853:Tenm4 UTSW 7 96837295 missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96797392 missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96895550 missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6939:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7011:Tenm4 UTSW 7 96896135 nonsense probably null
R7033:Tenm4 UTSW 7 96895223 nonsense probably null
R7040:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7083:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R7238:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96735813 missense possibly damaging 0.47
R7337:Tenm4 UTSW 7 96874126 missense probably benign 0.44
R7400:Tenm4 UTSW 7 96694803 missense probably damaging 0.97
R7407:Tenm4 UTSW 7 96773987 missense possibly damaging 0.89
R7449:Tenm4 UTSW 7 96874213 missense possibly damaging 0.65
R7473:Tenm4 UTSW 7 96774146 missense probably damaging 1.00
R7477:Tenm4 UTSW 7 96845808 missense probably damaging 0.99
R7489:Tenm4 UTSW 7 96837314 missense possibly damaging 0.90
R7498:Tenm4 UTSW 7 96848017 missense probably damaging 1.00
R7562:Tenm4 UTSW 7 96888814 missense probably damaging 1.00
R7615:Tenm4 UTSW 7 96845926 missense probably damaging 1.00
R7624:Tenm4 UTSW 7 96895985 missense possibly damaging 0.95
R7626:Tenm4 UTSW 7 96893014 missense probably damaging 1.00
R7690:Tenm4 UTSW 7 96863533 missense probably benign 0.00
R7692:Tenm4 UTSW 7 96895403 missense probably damaging 1.00
R7748:Tenm4 UTSW 7 96894702 missense probably damaging 1.00
R7763:Tenm4 UTSW 7 96895692 missense probably benign 0.38
R7792:Tenm4 UTSW 7 96774014 missense possibly damaging 0.54
R7855:Tenm4 UTSW 7 96873874 missense probably damaging 1.00
R7868:Tenm4 UTSW 7 96906380 missense possibly damaging 0.79
R7878:Tenm4 UTSW 7 96852357 missense probably damaging 1.00
R7997:Tenm4 UTSW 7 96874305 missense probably benign 0.44
R8017:Tenm4 UTSW 7 96704041 missense probably damaging 1.00
R8019:Tenm4 UTSW 7 96704041 missense probably damaging 1.00
R8054:Tenm4 UTSW 7 96729346 splice site probably benign
R8061:Tenm4 UTSW 7 96852456 missense probably damaging 1.00
R8108:Tenm4 UTSW 7 96854728 missense probably benign 0.39
R8140:Tenm4 UTSW 7 96895176 missense probably damaging 1.00
R8214:Tenm4 UTSW 7 96895407 missense probably damaging 1.00
R8258:Tenm4 UTSW 7 96867991 missense probably damaging 1.00
R8259:Tenm4 UTSW 7 96867991 missense probably damaging 1.00
R8364:Tenm4 UTSW 7 96772106 critical splice donor site probably null
R8542:Tenm4 UTSW 7 96811932 missense probably damaging 0.99
R8669:Tenm4 UTSW 7 96905941 missense probably benign
R8670:Tenm4 UTSW 7 96905941 missense probably benign
R8683:Tenm4 UTSW 7 96902857 missense probably damaging 0.99
R8691:Tenm4 UTSW 7 96905941 missense probably benign
R8692:Tenm4 UTSW 7 96905941 missense probably benign
R8714:Tenm4 UTSW 7 96905941 missense probably benign
R8716:Tenm4 UTSW 7 96905941 missense probably benign
R8735:Tenm4 UTSW 7 96905941 missense probably benign
R8736:Tenm4 UTSW 7 96905941 missense probably benign
R8737:Tenm4 UTSW 7 96905941 missense probably benign
R8738:Tenm4 UTSW 7 96873840 missense probably damaging 1.00
R8738:Tenm4 UTSW 7 96905941 missense probably benign
R8739:Tenm4 UTSW 7 96905941 missense probably benign
R8776:Tenm4 UTSW 7 96895032 missense probably damaging 1.00
R8776-TAIL:Tenm4 UTSW 7 96895032 missense probably damaging 1.00
R8777:Tenm4 UTSW 7 96896037 missense probably damaging 1.00
R8777-TAIL:Tenm4 UTSW 7 96896037 missense probably damaging 1.00
R8851:Tenm4 UTSW 7 96852503 missense probably damaging 1.00
R8913:Tenm4 UTSW 7 96702745 splice site probably benign
R8977:Tenm4 UTSW 7 96811970 missense probably damaging 1.00
R9100:Tenm4 UTSW 7 96845854 missense probably damaging 1.00
R9136:Tenm4 UTSW 7 96823918 missense possibly damaging 0.69
R9163:Tenm4 UTSW 7 96823873 missense probably damaging 1.00
R9188:Tenm4 UTSW 7 96772027 missense probably damaging 1.00
R9195:Tenm4 UTSW 7 96892919 missense probably damaging 1.00
R9217:Tenm4 UTSW 7 96885439 missense probably damaging 1.00
R9344:Tenm4 UTSW 7 96896145 missense probably damaging 1.00
R9414:Tenm4 UTSW 7 96896160 missense probably benign
R9466:Tenm4 UTSW 7 96550045 missense possibly damaging 0.79
R9559:Tenm4 UTSW 7 96823849 missense probably benign
R9626:Tenm4 UTSW 7 96896138 missense probably damaging 1.00
X0021:Tenm4 UTSW 7 96873909 nonsense probably null
X0026:Tenm4 UTSW 7 96868087 missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96848030 missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96894794 missense probably damaging 1.00
Z1176:Tenm4 UTSW 7 96905914 missense probably benign 0.00
Z1177:Tenm4 UTSW 7 96863585 missense probably damaging 0.96
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2021-04-30