Incidental Mutation 'R8817:Smarca5'
ID 672810
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8817 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 80698507-80739497 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80733750 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 119 (M119K)
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
AlphaFold Q91ZW3
Predicted Effect probably benign
Transcript: ENSMUST00000043359
AA Change: M119K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: M119K

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.0682 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,276,998 Y320H probably benign Het
Aass A T 6: 23,097,196 Y41* probably null Het
AI429214 G A 8: 36,994,114 V139I probably benign Het
Cacna1a G A 8: 84,638,797 A2190T probably benign Het
Cutc T C 19: 43,755,674 V38A probably benign Het
Cxcl10 G T 5: 92,347,371 P98H probably damaging Het
Dopey1 T C 9: 86,513,950 S822P possibly damaging Het
Dusp19 T C 2: 80,624,287 L117P probably damaging Het
Emc3 A G 6: 113,515,907 F261S probably damaging Het
Ephx2 T C 14: 66,107,276 T200A probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
Ethe1 T C 7: 24,606,302 I158T probably damaging Het
Fancm C T 12: 65,120,557 R1547C probably damaging Het
Fer1l4 T A 2: 156,048,223 T261S probably damaging Het
Fyb2 A G 4: 104,945,455 R185G probably benign Het
Gabrp A T 11: 33,554,464 S284T possibly damaging Het
Gga2 G A 7: 121,991,622 R488* probably null Het
Gm14085 A T 2: 122,518,507 T305S possibly damaging Het
Gm436 A G 4: 144,673,791 V139A probably benign Het
Gm9758 A G 5: 14,912,216 L126S probably damaging Het
Gse1 T C 8: 120,567,803 F290L probably damaging Het
Hdgfl1 A G 13: 26,770,085 S2P probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Huwe1 A G X: 151,886,997 K1482R probably benign Het
Lama2 A T 10: 27,187,873 W1307R probably damaging Het
Map3k6 A G 4: 133,246,760 K517E probably benign Het
Mbl1 T A 14: 41,153,598 L3Q unknown Het
Mepe G T 5: 104,337,285 R97L probably benign Het
Minpp1 T A 19: 32,486,347 M136K possibly damaging Het
Mrgprb1 T A 7: 48,447,322 I281F probably benign Het
Naip5 T C 13: 100,212,699 I1374V probably benign Het
Olfr1259 A G 2: 89,943,446 L223S probably damaging Het
Olfr603 A T 7: 103,383,618 I128N probably damaging Het
Olfr761 A G 17: 37,952,382 I214T probably damaging Het
Olfr954 C T 9: 39,462,091 S217F probably damaging Het
Olfr970 G T 9: 39,819,643 M1I probably null Het
Pamr1 T G 2: 102,634,421 V305G probably benign Het
Pcbp3 T C 10: 76,789,836 T125A probably benign Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Pitpnm3 T C 11: 72,051,068 E971G possibly damaging Het
Pkdrej A G 15: 85,818,573 V1054A probably damaging Het
Plcb1 G A 2: 135,333,509 probably benign Het
Prpf40a T C 2: 53,152,959 K480E probably damaging Het
Psd3 A G 8: 67,960,483 I465T possibly damaging Het
Pskh1 C T 8: 105,929,720 R343W probably damaging Het
Ptprz1 A T 6: 23,007,372 T1645S probably damaging Het
Rasal1 T C 5: 120,670,351 F483L probably damaging Het
Rbm28 T C 6: 29,155,024 probably benign Het
Recql G A 6: 142,358,886 probably benign Het
Rnf40 T C 7: 127,597,160 V760A probably damaging Het
Rp1l1 A T 14: 64,030,636 R1224W probably benign Het
Rpgrip1 T C 14: 52,140,599 V468A probably benign Het
Ryr2 T A 13: 11,735,623 I1921F possibly damaging Het
Sirpa G A 2: 129,593,638 G9D unknown Het
Slc40a1 A C 1: 45,909,539 V527G probably damaging Het
Smarca4 T A 9: 21,636,201 M260K probably benign Het
Smg1 A G 7: 118,159,664 V2206A unknown Het
Sp4 A T 12: 118,261,889 V580D possibly damaging Het
Spata31d1c G A 13: 65,034,562 C75Y probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Srcap T C 7: 127,553,223 S2220P probably benign Het
Stra6 G T 9: 58,151,982 V543F possibly damaging Het
Tenm4 T A 7: 96,874,128 F1626I probably benign Het
Tjp1 T C 7: 65,303,062 N1508S probably benign Het
Trrap T A 5: 144,845,538 L3298Q probably damaging Het
Tsn A G 1: 118,304,740 L135P probably damaging Het
Ttl A T 2: 129,068,858 H54L probably damaging Het
Ttn T A 2: 76,829,907 T12110S unknown Het
Uba6 T C 5: 86,148,913 I306V probably null Het
Ubap2 A G 4: 41,223,425 S204P possibly damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Ush2a A T 1: 188,263,034 M1L probably benign Het
Vmn1r159 C A 7: 22,843,134 V158F probably benign Het
Wif1 A G 10: 121,096,716 H333R possibly damaging Het
Zfp282 T A 6: 47,904,826 N482K probably benign Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 80714041 missense probably benign 0.10
IGL01138:Smarca5 APN 8 80701076 missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 80727648 missense probably benign
IGL02338:Smarca5 APN 8 80719570 splice site probably benign
IGL03212:Smarca5 APN 8 80711781 missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 80719658 missense probably damaging 1.00
Cipher UTSW 8 80719652 missense probably damaging 1.00
Codebook UTSW 8 80733707 missense probably benign
Codex UTSW 8 80710563 missense probably damaging 0.99
Enigma UTSW 8 80705332 missense probably benign 0.35
Key UTSW 8 80726051 missense probably damaging 1.00
tinker UTSW 8 80733750 missense probably benign
R0254:Smarca5 UTSW 8 80704700 missense probably benign 0.05
R0374:Smarca5 UTSW 8 80736731 missense probably benign 0.30
R0625:Smarca5 UTSW 8 80720686 critical splice donor site probably null
R1065:Smarca5 UTSW 8 80704714 missense probably damaging 1.00
R1164:Smarca5 UTSW 8 80710631 missense probably damaging 1.00
R1709:Smarca5 UTSW 8 80709220 nonsense probably null
R2102:Smarca5 UTSW 8 80704675 missense probably damaging 1.00
R3831:Smarca5 UTSW 8 80728494 missense probably damaging 0.99
R4625:Smarca5 UTSW 8 80710563 missense probably damaging 0.99
R4750:Smarca5 UTSW 8 80733707 missense probably benign
R4822:Smarca5 UTSW 8 80708680 splice site probably null
R4889:Smarca5 UTSW 8 80704697 missense possibly damaging 0.95
R5756:Smarca5 UTSW 8 80710604 missense probably benign
R6120:Smarca5 UTSW 8 80711743 missense probably damaging 0.98
R6582:Smarca5 UTSW 8 80719652 missense probably damaging 1.00
R6939:Smarca5 UTSW 8 80705320 missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R6973:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R7027:Smarca5 UTSW 8 80736726 missense probably benign 0.07
R7376:Smarca5 UTSW 8 80726051 missense probably damaging 1.00
R7514:Smarca5 UTSW 8 80717534 missense probably damaging 1.00
R7962:Smarca5 UTSW 8 80736759 missense probably benign
R8031:Smarca5 UTSW 8 80704682 missense probably damaging 1.00
R8400:Smarca5 UTSW 8 80709127 missense probably benign 0.02
R8798:Smarca5 UTSW 8 80716508 missense probably damaging 1.00
R8824:Smarca5 UTSW 8 80705332 missense probably benign 0.35
R8905:Smarca5 UTSW 8 80713948 missense probably benign 0.14
R9018:Smarca5 UTSW 8 80704726 missense probably damaging 1.00
R9028:Smarca5 UTSW 8 80714013 missense probably damaging 1.00
R9203:Smarca5 UTSW 8 80704629 nonsense probably null
R9253:Smarca5 UTSW 8 80719715 missense probably damaging 1.00
R9294:Smarca5 UTSW 8 80719803 missense probably damaging 1.00
R9328:Smarca5 UTSW 8 80720749 missense probably benign 0.00
R9396:Smarca5 UTSW 8 80736729 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATCTTCATGTCATGTACAGCATGG -3'
(R):5'- ACCCAAGTAGCATGTTTCAGGAG -3'

Sequencing Primer
(F):5'- GCATGGCTGTTAACAATTCATAAAGC -3'
(R):5'- CCAAGTAGCATGTTTCAGGAGTTTAC -3'
Posted On 2021-04-30