Incidental Mutation 'R8817:Sppl2b'
ID 672821
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Name signal peptide peptidase like 2B
Synonyms 3110056O03Rik
MMRRC Submission 068727-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R8817 (G1)
Quality Score 217.468
Status Not validated
Chromosome 10
Chromosomal Location 80691109-80704542 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80701903 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
AlphaFold Q3TD49
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A G 4: 144,400,361 (GRCm39) V139A probably benign Het
Aass A T 6: 23,097,195 (GRCm39) Y41* probably null Het
AI429214 G A 8: 37,461,268 (GRCm39) V139I probably benign Het
Cacna1a G A 8: 85,365,426 (GRCm39) A2190T probably benign Het
Cstpp1 A G 2: 91,107,343 (GRCm39) Y320H probably benign Het
Cutc T C 19: 43,744,113 (GRCm39) V38A probably benign Het
Cxcl10 G T 5: 92,495,230 (GRCm39) P98H probably damaging Het
Dop1a T C 9: 86,396,003 (GRCm39) S822P possibly damaging Het
Dusp19 T C 2: 80,454,631 (GRCm39) L117P probably damaging Het
Emc3 A G 6: 113,492,868 (GRCm39) F261S probably damaging Het
Ephx2 T C 14: 66,344,725 (GRCm39) T200A probably benign Het
Eri1 A C 8: 35,945,792 (GRCm39) D164E probably damaging Het
Ethe1 T C 7: 24,305,727 (GRCm39) I158T probably damaging Het
Fancm C T 12: 65,167,331 (GRCm39) R1547C probably damaging Het
Fer1l4 T A 2: 155,890,143 (GRCm39) T261S probably damaging Het
Fyb2 A G 4: 104,802,652 (GRCm39) R185G probably benign Het
Gabrp A T 11: 33,504,464 (GRCm39) S284T possibly damaging Het
Gga2 G A 7: 121,590,845 (GRCm39) R488* probably null Het
Gm9758 A G 5: 14,962,230 (GRCm39) L126S probably damaging Het
Gse1 T C 8: 121,294,542 (GRCm39) F290L probably damaging Het
Hdgfl1 A G 13: 26,954,068 (GRCm39) S2P probably damaging Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Huwe1 A G X: 150,669,993 (GRCm39) K1482R probably benign Het
Lama2 A T 10: 27,063,869 (GRCm39) W1307R probably damaging Het
Map3k6 A G 4: 132,974,071 (GRCm39) K517E probably benign Het
Mbl1 T A 14: 40,875,555 (GRCm39) L3Q unknown Het
Mepe G T 5: 104,485,151 (GRCm39) R97L probably benign Het
Minpp1 T A 19: 32,463,747 (GRCm39) M136K possibly damaging Het
Mrgprb1 T A 7: 48,097,070 (GRCm39) I281F probably benign Het
Naip5 T C 13: 100,349,207 (GRCm39) I1374V probably benign Het
Or14j8 A G 17: 38,263,273 (GRCm39) I214T probably damaging Het
Or4c12 A G 2: 89,773,790 (GRCm39) L223S probably damaging Het
Or52e19b A T 7: 103,032,825 (GRCm39) I128N probably damaging Het
Or8g34 C T 9: 39,373,387 (GRCm39) S217F probably damaging Het
Or8g37 G T 9: 39,730,939 (GRCm39) M1I probably null Het
Pamr1 T G 2: 102,464,766 (GRCm39) V305G probably benign Het
Pcbp3 T C 10: 76,625,670 (GRCm39) T125A probably benign Het
Peli2 G A 14: 48,490,130 (GRCm39) E201K possibly damaging Het
Pitpnm3 T C 11: 71,941,894 (GRCm39) E971G possibly damaging Het
Pkdrej A G 15: 85,702,774 (GRCm39) V1054A probably damaging Het
Plcb1 G A 2: 135,175,429 (GRCm39) probably benign Het
Prpf40a T C 2: 53,042,971 (GRCm39) K480E probably damaging Het
Psd3 A G 8: 68,413,135 (GRCm39) I465T possibly damaging Het
Pskh1 C T 8: 106,656,352 (GRCm39) R343W probably damaging Het
Ptprz1 A T 6: 23,007,371 (GRCm39) T1645S probably damaging Het
Rasal1 T C 5: 120,808,416 (GRCm39) F483L probably damaging Het
Rbm28 T C 6: 29,155,023 (GRCm39) probably benign Het
Recql G A 6: 142,304,612 (GRCm39) probably benign Het
Rnf40 T C 7: 127,196,332 (GRCm39) V760A probably damaging Het
Rp1l1 A T 14: 64,268,085 (GRCm39) R1224W probably benign Het
Rpgrip1 T C 14: 52,378,056 (GRCm39) V468A probably benign Het
Ryr2 T A 13: 11,750,509 (GRCm39) I1921F possibly damaging Het
Sirpa G A 2: 129,435,558 (GRCm39) G9D unknown Het
Slc28a2b A T 2: 122,348,988 (GRCm39) T305S possibly damaging Het
Slc40a1 A C 1: 45,948,699 (GRCm39) V527G probably damaging Het
Smarca4 T A 9: 21,547,497 (GRCm39) M260K probably benign Het
Smarca5 A T 8: 81,460,379 (GRCm39) M119K probably benign Het
Smg1 A G 7: 117,758,887 (GRCm39) V2206A unknown Het
Sp4 A T 12: 118,225,624 (GRCm39) V580D possibly damaging Het
Spata31d1c G A 13: 65,182,376 (GRCm39) C75Y probably damaging Het
Srcap T C 7: 127,152,395 (GRCm39) S2220P probably benign Het
Stra6 G T 9: 58,059,265 (GRCm39) V543F possibly damaging Het
Tenm4 T A 7: 96,523,335 (GRCm39) F1626I probably benign Het
Tjp1 T C 7: 64,952,810 (GRCm39) N1508S probably benign Het
Trrap T A 5: 144,782,348 (GRCm39) L3298Q probably damaging Het
Tsn A G 1: 118,232,470 (GRCm39) L135P probably damaging Het
Ttl A T 2: 128,910,778 (GRCm39) H54L probably damaging Het
Ttn T A 2: 76,660,251 (GRCm39) T12110S unknown Het
Uba6 T C 5: 86,296,772 (GRCm39) I306V probably null Het
Ubap2 A G 4: 41,223,425 (GRCm39) S204P possibly damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Ush2a A T 1: 187,995,231 (GRCm39) M1L probably benign Het
Vmn1r159 C A 7: 22,542,559 (GRCm39) V158F probably benign Het
Wif1 A G 10: 120,932,621 (GRCm39) H333R possibly damaging Het
Zfp282 T A 6: 47,881,760 (GRCm39) N482K probably benign Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80,699,928 (GRCm39) missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80,701,175 (GRCm39) missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80,697,220 (GRCm39) missense probably benign 0.00
IGL01964:Sppl2b APN 10 80,701,220 (GRCm39) critical splice donor site probably null
IGL02376:Sppl2b APN 10 80,703,432 (GRCm39) nonsense probably null
R1641:Sppl2b UTSW 10 80,700,965 (GRCm39) missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80,701,451 (GRCm39) missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R3106:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R4350:Sppl2b UTSW 10 80,698,560 (GRCm39) missense probably benign 0.12
R5146:Sppl2b UTSW 10 80,703,474 (GRCm39) makesense probably null
R5698:Sppl2b UTSW 10 80,701,879 (GRCm39) splice site probably null
R6969:Sppl2b UTSW 10 80,700,959 (GRCm39) missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80,703,253 (GRCm39) missense probably benign 0.02
R8212:Sppl2b UTSW 10 80,701,193 (GRCm39) missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8265:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8367:Sppl2b UTSW 10 80,699,025 (GRCm39) missense probably benign 0.02
R8398:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8398:Sppl2b UTSW 10 80,701,902 (GRCm39) frame shift probably null
R8400:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8480:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8481:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8505:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8818:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8832:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R9175:Sppl2b UTSW 10 80,698,807 (GRCm39) missense probably benign
R9624:Sppl2b UTSW 10 80,699,373 (GRCm39) missense probably benign 0.03
Z1176:Sppl2b UTSW 10 80,703,259 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGTGCATGCCCATTGTCACC -3'
(R):5'- TTGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'
Posted On 2021-04-30