Incidental Mutation 'R8817:Pkdrej'
ID672842
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R8817 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85818573 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1054 (V1054A)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370]
Predicted Effect probably damaging
Transcript: ENSMUST00000064370
AA Change: V1054A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: V1054A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,276,998 Y320H probably benign Het
Aass A T 6: 23,097,196 Y41* probably null Het
AI429214 G A 8: 36,994,114 V139I probably benign Het
Cacna1a G A 8: 84,638,797 A2190T probably benign Het
Cutc T C 19: 43,755,674 V38A probably benign Het
Cxcl10 G T 5: 92,347,371 P98H probably damaging Het
Dopey1 T C 9: 86,513,950 S822P possibly damaging Het
Dusp19 T C 2: 80,624,287 L117P probably damaging Het
Emc3 A G 6: 113,515,907 F261S probably damaging Het
Ephx2 T C 14: 66,107,276 T200A probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
Ethe1 T C 7: 24,606,302 I158T probably damaging Het
Fancm C T 12: 65,120,557 R1547C probably damaging Het
Fer1l4 T A 2: 156,048,223 T261S probably damaging Het
Fyb2 A G 4: 104,945,455 R185G probably benign Het
Gabrp A T 11: 33,554,464 S284T possibly damaging Het
Gga2 G A 7: 121,991,622 R488* probably null Het
Gm14085 A T 2: 122,518,507 T305S possibly damaging Het
Gm436 A G 4: 144,673,791 V139A probably benign Het
Gm9758 A G 5: 14,912,216 L126S probably damaging Het
Gse1 T C 8: 120,567,803 F290L probably damaging Het
Hdgfl1 A G 13: 26,770,085 S2P probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Huwe1 A G X: 151,886,997 K1482R probably benign Het
Lama2 A T 10: 27,187,873 W1307R probably damaging Het
Map3k6 A G 4: 133,246,760 K517E probably benign Het
Mbl1 T A 14: 41,153,598 L3Q unknown Het
Mepe G T 5: 104,337,285 R97L probably benign Het
Minpp1 T A 19: 32,486,347 M136K possibly damaging Het
Mrgprb1 T A 7: 48,447,322 I281F probably benign Het
Naip5 T C 13: 100,212,699 I1374V probably benign Het
Olfr1259 A G 2: 89,943,446 L223S probably damaging Het
Olfr603 A T 7: 103,383,618 I128N probably damaging Het
Olfr761 A G 17: 37,952,382 I214T probably damaging Het
Olfr954 C T 9: 39,462,091 S217F probably damaging Het
Olfr970 G T 9: 39,819,643 M1I probably null Het
Pamr1 T G 2: 102,634,421 V305G probably benign Het
Pcbp3 T C 10: 76,789,836 T125A probably benign Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Pitpnm3 T C 11: 72,051,068 E971G possibly damaging Het
Prpf40a T C 2: 53,152,959 K480E probably damaging Het
Psd3 A G 8: 67,960,483 I465T possibly damaging Het
Pskh1 C T 8: 105,929,720 R343W probably damaging Het
Ptprz1 A T 6: 23,007,372 T1645S probably damaging Het
Rasal1 T C 5: 120,670,351 F483L probably damaging Het
Rnf40 T C 7: 127,597,160 V760A probably damaging Het
Rp1l1 A T 14: 64,030,636 R1224W probably benign Het
Rpgrip1 T C 14: 52,140,599 V468A probably benign Het
Ryr2 T A 13: 11,735,623 I1921F possibly damaging Het
Sirpa G A 2: 129,593,638 G9D unknown Het
Slc40a1 A C 1: 45,909,539 V527G probably damaging Het
Smarca4 T A 9: 21,636,201 M260K probably benign Het
Smarca5 A T 8: 80,733,750 M119K probably benign Het
Smg1 A G 7: 118,159,664 V2206A unknown Het
Sp4 A T 12: 118,261,889 V580D possibly damaging Het
Spata31d1c G A 13: 65,034,562 C75Y probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Srcap T C 7: 127,553,223 S2220P probably benign Het
Stra6 G T 9: 58,151,982 V543F possibly damaging Het
Tenm4 T A 7: 96,874,128 F1626I probably benign Het
Tjp1 T C 7: 65,303,062 N1508S probably benign Het
Trrap T A 5: 144,845,538 L3298Q probably damaging Het
Tsn A G 1: 118,304,740 L135P probably damaging Het
Ttl A T 2: 129,068,858 H54L probably damaging Het
Ttn T A 2: 76,829,907 T12110S unknown Het
Uba6 T C 5: 86,148,913 I306V probably null Het
Ubap2 A G 4: 41,223,425 S204P possibly damaging Het
Unc13d GCT GCTGCAATGCCT 11: 116,068,167 probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Unc13d TGCCT TGCCTGCCAGGCCT 11: 116,068,174 probably benign Het
Unc13d CTCCCATGC CTCCCATGCATCCCATGC 11: 116,068,177 probably benign Het
Unc13d ATGCC ATGCCTCCCTTGCC 11: 116,068,182 probably benign Het
Ush2a A T 1: 188,263,034 M1L probably benign Het
Vmn1r159 C A 7: 22,843,134 V158F probably benign Het
Wif1 A G 10: 121,096,716 H333R possibly damaging Het
Zfp282 T A 6: 47,904,826 N482K probably benign Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85819935 missense probably benign 0.01
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 splice site probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85817133 missense probably benign 0.37
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1779:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2069:Pkdrej UTSW 15 85821231 missense probably benign 0.01
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85821105 nonsense probably null
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6786:Pkdrej UTSW 15 85818649 missense probably benign
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85816188 missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85821148 missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85821100 missense probably benign
R7549:Pkdrej UTSW 15 85819793 missense probably damaging 1.00
R7582:Pkdrej UTSW 15 85818921 missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85815587 missense probably benign 0.01
R7791:Pkdrej UTSW 15 85815931 missense possibly damaging 0.87
R7873:Pkdrej UTSW 15 85816523 missense probably benign 0.29
R8121:Pkdrej UTSW 15 85815454 missense probably benign 0.00
R8140:Pkdrej UTSW 15 85818410 missense probably damaging 1.00
R8219:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
R8222:Pkdrej UTSW 15 85817439 missense probably benign
R8432:Pkdrej UTSW 15 85817293 missense probably benign 0.00
R8755:Pkdrej UTSW 15 85819606 missense probably benign 0.00
R8786:Pkdrej UTSW 15 85819843 missense probably benign 0.01
R8827:Pkdrej UTSW 15 85815531 missense possibly damaging 0.76
Z1177:Pkdrej UTSW 15 85816537 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGACTCCCAGTAAAGATGGTTAC -3'
(R):5'- TATGGGATCCAGAGTGATTGGC -3'

Sequencing Primer
(F):5'- CCCAGTAAAGATGGTTACTAGATAGC -3'
(R):5'- CAACAAAGTACCTGCGTGCTGG -3'
Posted On2021-04-30