Incidental Mutation 'R8818:4932438A13Rik'
ID 672850
Institutional Source Beutler Lab
Gene Symbol 4932438A13Rik
Ensembl Gene ENSMUSG00000037270
Gene Name RIKEN cDNA 4932438A13 gene
Synonyms Tweek, FSA
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8818 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 36863104-37053033 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 36996548 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 3011 (M3011R)
Ref Sequence ENSEMBL: ENSMUSP00000060199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000152564] [ENSMUST00000211820]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000057272
AA Change: M3011R

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270
AA Change: M3011R

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152564
AA Change: M3011R

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270
AA Change: M3011R

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211820
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G T 7: 120,216,301 M257I probably benign Het
Adam23 T C 1: 63,545,468 V345A probably damaging Het
Anxa6 T G 11: 55,011,752 N52T possibly damaging Het
Arhgef15 G A 11: 68,951,112 H496Y probably damaging Het
Atp2a3 A G 11: 72,981,939 E771G probably damaging Het
B3gnt5 A G 16: 19,769,597 T189A possibly damaging Het
Becn1 A T 11: 101,295,404 S125T probably damaging Het
Ccdc180 A G 4: 45,900,484 M283V probably benign Het
Cdh17 T C 4: 11,771,323 F35S probably damaging Het
Clcn1 T A 6: 42,305,543 I515N probably damaging Het
Cyp4f17 A G 17: 32,524,094 Y247C probably damaging Het
Dcp1a T A 14: 30,518,942 H236Q possibly damaging Het
Dnah11 T A 12: 117,911,029 N4034Y probably damaging Het
Dsg1a A G 18: 20,340,542 I891V possibly damaging Het
Eid3 A G 10: 82,867,607 N301D probably damaging Het
Fbrs C A 7: 127,479,522 D108E unknown Het
Fbxw14 A C 9: 109,287,003 probably benign Het
Fzd8 A G 18: 9,214,474 T519A probably benign Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm35911 A T 5: 99,941,235 N120Y probably damaging Het
Gpr3 C A 4: 133,211,227 V45L possibly damaging Het
Gramd1b A T 9: 40,304,484 I690K probably benign Het
Grhl2 T A 15: 37,270,668 D33E probably damaging Het
Kcnj4 C A 15: 79,485,719 R20L probably damaging Het
Klhl5 A G 5: 65,148,646 I319V probably benign Het
Lars2 A T 9: 123,392,827 E135D possibly damaging Het
Map9 T A 3: 82,383,963 Y602N possibly damaging Het
Mphosph9 A T 5: 124,324,964 L6* probably null Het
Naa35 C T 13: 59,600,947 T131M probably damaging Het
Nucb2 T A 7: 116,521,901 L22Q possibly damaging Het
Olfr1066 C A 2: 86,455,734 C179F probably damaging Het
Olfr943 A G 9: 39,184,766 Y193C probably damaging Het
Pcdhb6 C T 18: 37,335,784 T586I probably benign Het
Ppcs A T 4: 119,422,133 L74Q probably damaging Het
Ppp6r3 A T 19: 3,467,216 V677D probably benign Het
Psg27 C T 7: 18,560,412 G357S probably damaging Het
Ptgdr2 A G 19: 10,941,016 N299S probably damaging Het
Relb T A 7: 19,619,837 I39F probably damaging Het
Ripor2 T A 13: 24,717,668 S907R possibly damaging Het
Rnf170 T G 8: 26,139,015 D172E probably benign Het
Rnf31 C A 14: 55,594,939 Q273K probably benign Het
Rrp36 A T 17: 46,672,410 S93T probably damaging Het
Rsad1 A T 11: 94,548,274 V120D probably benign Het
Ryr3 C T 2: 112,831,096 A1870T probably damaging Het
Serpina10 T G 12: 103,628,804 D52A probably benign Het
Slc47a1 A G 11: 61,370,229 I115T probably benign Het
Spag17 T A 3: 100,013,227 M426K probably benign Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Sptbn4 T G 7: 27,364,167 E2283A possibly damaging Het
Top3a A G 11: 60,743,051 C740R probably damaging Het
Tpgs2 A T 18: 25,158,308 V33E probably damaging Het
Treh T C 9: 44,681,526 I116T probably damaging Het
Trpm3 A T 19: 22,978,588 N1138I possibly damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Zswim9 G T 7: 13,260,529 Q567K probably benign Het
Other mutations in 4932438A13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:4932438A13Rik APN 3 37011727 missense probably benign 0.00
IGL00434:4932438A13Rik APN 3 36987299 missense probably damaging 0.98
IGL00640:4932438A13Rik APN 3 36908218 missense probably damaging 1.00
IGL00693:4932438A13Rik APN 3 37052547 utr 3 prime probably benign
IGL00721:4932438A13Rik APN 3 37030751 splice site probably null
IGL00756:4932438A13Rik APN 3 36908218 missense probably damaging 1.00
IGL00896:4932438A13Rik APN 3 37039462 missense probably benign
IGL00902:4932438A13Rik APN 3 37041345 missense probably damaging 1.00
IGL00980:4932438A13Rik APN 3 37000041 missense probably damaging 1.00
IGL01019:4932438A13Rik APN 3 37006984 critical splice acceptor site probably null
IGL01025:4932438A13Rik APN 3 37046280 missense possibly damaging 0.89
IGL01306:4932438A13Rik APN 3 37005013 splice site probably benign
IGL01370:4932438A13Rik APN 3 36947755 missense probably benign 0.07
IGL01377:4932438A13Rik APN 3 36973452 critical splice donor site probably null
IGL01401:4932438A13Rik APN 3 36942292 missense probably benign
IGL01419:4932438A13Rik APN 3 37048121 missense probably damaging 1.00
IGL01432:4932438A13Rik APN 3 37003759 missense possibly damaging 0.87
IGL01433:4932438A13Rik APN 3 36887770 missense probably damaging 1.00
IGL01452:4932438A13Rik APN 3 36996308 unclassified probably benign
IGL01520:4932438A13Rik APN 3 36973260 nonsense probably null
IGL01524:4932438A13Rik APN 3 36942382 missense possibly damaging 0.90
IGL01628:4932438A13Rik APN 3 37008485 missense probably damaging 1.00
IGL01638:4932438A13Rik APN 3 36974311 missense probably damaging 1.00
IGL01650:4932438A13Rik APN 3 36992673 splice site probably benign
IGL01717:4932438A13Rik APN 3 37034736 missense probably benign
IGL01767:4932438A13Rik APN 3 37041363 missense probably benign 0.29
IGL01813:4932438A13Rik APN 3 36928520 missense possibly damaging 0.90
IGL01998:4932438A13Rik APN 3 36957016 missense possibly damaging 0.49
IGL02172:4932438A13Rik APN 3 37004873 missense probably damaging 0.99
IGL02197:4932438A13Rik APN 3 36906735 missense probably damaging 1.00
IGL02248:4932438A13Rik APN 3 36969290 critical splice donor site probably null
IGL02273:4932438A13Rik APN 3 36921437 splice site probably benign
IGL02403:4932438A13Rik APN 3 37030664 missense probably benign
IGL02492:4932438A13Rik APN 3 37048113 missense probably benign 0.04
IGL02517:4932438A13Rik APN 3 36958868 missense probably damaging 1.00
IGL02519:4932438A13Rik APN 3 36895315 missense probably damaging 1.00
IGL02586:4932438A13Rik APN 3 37044608 nonsense probably null
IGL02620:4932438A13Rik APN 3 37035945 missense possibly damaging 0.95
IGL02621:4932438A13Rik APN 3 37041484 splice site probably benign
IGL02670:4932438A13Rik APN 3 36967305 nonsense probably null
IGL02806:4932438A13Rik APN 3 36946494 missense possibly damaging 0.95
IGL02985:4932438A13Rik APN 3 36958757 missense probably damaging 0.99
IGL03004:4932438A13Rik APN 3 36965677 splice site probably benign
IGL03037:4932438A13Rik APN 3 36969207 missense probably benign 0.23
IGL03037:4932438A13Rik APN 3 36969208 missense probably damaging 1.00
IGL03062:4932438A13Rik APN 3 37038517 splice site probably benign
IGL03137:4932438A13Rik APN 3 37034602 missense probably damaging 0.98
IGL03150:4932438A13Rik APN 3 36948066 missense probably damaging 1.00
IGL03204:4932438A13Rik APN 3 37050934 splice site probably benign
IGL03207:4932438A13Rik APN 3 36949996 missense possibly damaging 0.73
IGL03256:4932438A13Rik APN 3 36906683 splice site probably benign
IGL03264:4932438A13Rik APN 3 37002635 missense probably damaging 1.00
IGL03265:4932438A13Rik APN 3 37047991 missense probably benign 0.00
IGL03303:4932438A13Rik APN 3 36870077 missense possibly damaging 0.90
admonished UTSW 3 36948304 missense probably damaging 1.00
alerted UTSW 3 37033265 missense possibly damaging 0.85
informed UTSW 3 36965849 missense probably damaging 1.00
tipped UTSW 3 36988085 missense possibly damaging 0.81
warned UTSW 3 36965621 missense probably damaging 1.00
FR4340:4932438A13Rik UTSW 3 37050752 critical splice acceptor site probably benign
FR4737:4932438A13Rik UTSW 3 37050754 critical splice acceptor site probably benign
PIT4515001:4932438A13Rik UTSW 3 36974236 missense probably damaging 1.00
R0035:4932438A13Rik UTSW 3 36987598 nonsense probably null
R0047:4932438A13Rik UTSW 3 36908192 missense possibly damaging 0.83
R0047:4932438A13Rik UTSW 3 36908192 missense possibly damaging 0.83
R0068:4932438A13Rik UTSW 3 36952221 missense probably benign 0.28
R0068:4932438A13Rik UTSW 3 36952221 missense probably benign 0.28
R0092:4932438A13Rik UTSW 3 37028159 missense probably benign 0.41
R0233:4932438A13Rik UTSW 3 36948563 nonsense probably null
R0233:4932438A13Rik UTSW 3 36948563 nonsense probably null
R0256:4932438A13Rik UTSW 3 36917773 missense probably benign 0.01
R0277:4932438A13Rik UTSW 3 36943182 nonsense probably null
R0321:4932438A13Rik UTSW 3 36906788 splice site probably null
R0323:4932438A13Rik UTSW 3 36943182 nonsense probably null
R0335:4932438A13Rik UTSW 3 36969152 missense probably damaging 1.00
R0375:4932438A13Rik UTSW 3 37046252 missense probably damaging 0.99
R0437:4932438A13Rik UTSW 3 36989804 missense possibly damaging 0.81
R0445:4932438A13Rik UTSW 3 37000065 missense probably damaging 0.99
R0496:4932438A13Rik UTSW 3 36987635 missense probably damaging 1.00
R0531:4932438A13Rik UTSW 3 37036825 missense probably damaging 1.00
R0543:4932438A13Rik UTSW 3 36996458 missense probably benign 0.22
R0545:4932438A13Rik UTSW 3 36987690 splice site probably benign
R0674:4932438A13Rik UTSW 3 37044626 missense possibly damaging 0.86
R0745:4932438A13Rik UTSW 3 36928463 missense probably damaging 1.00
R0755:4932438A13Rik UTSW 3 36946364 missense probably damaging 1.00
R0785:4932438A13Rik UTSW 3 36959334 splice site probably benign
R1056:4932438A13Rik UTSW 3 36983453 missense possibly damaging 0.69
R1056:4932438A13Rik UTSW 3 37044680 missense probably benign 0.44
R1080:4932438A13Rik UTSW 3 36988255 missense probably damaging 1.00
R1103:4932438A13Rik UTSW 3 36996523 missense probably benign
R1119:4932438A13Rik UTSW 3 36987045 missense probably damaging 1.00
R1170:4932438A13Rik UTSW 3 37044631 missense probably damaging 0.98
R1183:4932438A13Rik UTSW 3 36895303 missense possibly damaging 0.51
R1186:4932438A13Rik UTSW 3 36996312 unclassified probably benign
R1201:4932438A13Rik UTSW 3 36948375 missense probably benign
R1219:4932438A13Rik UTSW 3 36946470 nonsense probably null
R1270:4932438A13Rik UTSW 3 36952184 missense probably damaging 1.00
R1273:4932438A13Rik UTSW 3 36987210 missense probably damaging 1.00
R1338:4932438A13Rik UTSW 3 37052535 missense unknown
R1364:4932438A13Rik UTSW 3 36987030 missense probably damaging 1.00
R1437:4932438A13Rik UTSW 3 36942429 missense possibly damaging 0.65
R1447:4932438A13Rik UTSW 3 36965586 missense probably damaging 0.98
R1467:4932438A13Rik UTSW 3 37035945 missense probably damaging 0.99
R1467:4932438A13Rik UTSW 3 37035945 missense probably damaging 0.99
R1470:4932438A13Rik UTSW 3 36998331 missense probably benign 0.31
R1470:4932438A13Rik UTSW 3 36998331 missense probably benign 0.31
R1481:4932438A13Rik UTSW 3 37008434 missense probably damaging 0.99
R1528:4932438A13Rik UTSW 3 37052535 missense unknown
R1533:4932438A13Rik UTSW 3 37041375 missense probably damaging 1.00
R1546:4932438A13Rik UTSW 3 36870056 missense possibly damaging 0.64
R1606:4932438A13Rik UTSW 3 36942399 missense probably damaging 1.00
R1638:4932438A13Rik UTSW 3 37035812 nonsense probably null
R1772:4932438A13Rik UTSW 3 36959432 missense probably damaging 1.00
R1896:4932438A13Rik UTSW 3 36908231 nonsense probably null
R1919:4932438A13Rik UTSW 3 37006983 critical splice acceptor site probably null
R1983:4932438A13Rik UTSW 3 36887865 missense probably null 1.00
R1987:4932438A13Rik UTSW 3 36953985 critical splice donor site probably null
R1992:4932438A13Rik UTSW 3 37000032 missense probably benign 0.32
R1999:4932438A13Rik UTSW 3 36908211 missense probably damaging 1.00
R2004:4932438A13Rik UTSW 3 36895378 missense possibly damaging 0.77
R2010:4932438A13Rik UTSW 3 36928551 missense probably benign 0.09
R2027:4932438A13Rik UTSW 3 37047961 splice site probably benign
R2039:4932438A13Rik UTSW 3 37003878 missense possibly damaging 0.66
R2054:4932438A13Rik UTSW 3 36947853 missense probably benign 0.01
R2089:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36953970 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2220:4932438A13Rik UTSW 3 36875530 critical splice donor site probably null
R2374:4932438A13Rik UTSW 3 36885396 missense probably benign 0.00
R2437:4932438A13Rik UTSW 3 36958685 splice site probably null
R2860:4932438A13Rik UTSW 3 36965849 missense probably damaging 1.00
R2861:4932438A13Rik UTSW 3 36965849 missense probably damaging 1.00
R2909:4932438A13Rik UTSW 3 36947953 missense probably damaging 1.00
R2925:4932438A13Rik UTSW 3 37007122 missense probably damaging 0.99
R2940:4932438A13Rik UTSW 3 36958805 missense probably damaging 1.00
R3015:4932438A13Rik UTSW 3 36875462 missense probably damaging 1.00
R3086:4932438A13Rik UTSW 3 37011703 missense possibly damaging 0.56
R3159:4932438A13Rik UTSW 3 36959415 missense probably benign 0.17
R3440:4932438A13Rik UTSW 3 37041912 nonsense probably null
R3703:4932438A13Rik UTSW 3 36987581 missense probably damaging 1.00
R3705:4932438A13Rik UTSW 3 36987581 missense probably damaging 1.00
R3795:4932438A13Rik UTSW 3 37030565 missense probably benign 0.30
R3820:4932438A13Rik UTSW 3 37040434 missense probably damaging 1.00
R3862:4932438A13Rik UTSW 3 36885398 missense possibly damaging 0.73
R3944:4932438A13Rik UTSW 3 37030061 missense possibly damaging 0.90
R4020:4932438A13Rik UTSW 3 37012575 intron probably benign
R4091:4932438A13Rik UTSW 3 37030589 missense probably benign 0.00
R4159:4932438A13Rik UTSW 3 36931083 missense probably benign 0.00
R4231:4932438A13Rik UTSW 3 36920236 missense probably benign 0.10
R4368:4932438A13Rik UTSW 3 36988147 nonsense probably null
R4413:4932438A13Rik UTSW 3 36958681 splice site probably null
R4475:4932438A13Rik UTSW 3 37040395 missense probably damaging 1.00
R4488:4932438A13Rik UTSW 3 37003933 missense probably null 0.93
R4489:4932438A13Rik UTSW 3 37003933 missense probably null 0.93
R4516:4932438A13Rik UTSW 3 36895311 missense possibly damaging 0.90
R4580:4932438A13Rik UTSW 3 37030025 missense probably benign 0.02
R4672:4932438A13Rik UTSW 3 36889990 makesense probably null
R4705:4932438A13Rik UTSW 3 37041889 missense probably benign 0.03
R4735:4932438A13Rik UTSW 3 37004967 missense possibly damaging 0.84
R4741:4932438A13Rik UTSW 3 36942375 missense probably damaging 0.99
R4754:4932438A13Rik UTSW 3 37022466 nonsense probably null
R4778:4932438A13Rik UTSW 3 36937065 missense possibly damaging 0.90
R4833:4932438A13Rik UTSW 3 36964968 missense probably damaging 0.96
R4896:4932438A13Rik UTSW 3 36965937 missense probably damaging 1.00
R4910:4932438A13Rik UTSW 3 36998199 missense probably damaging 1.00
R4922:4932438A13Rik UTSW 3 36987165 missense probably damaging 1.00
R4941:4932438A13Rik UTSW 3 36917702 missense probably damaging 1.00
R4941:4932438A13Rik UTSW 3 36919901 missense probably benign 0.41
R4980:4932438A13Rik UTSW 3 36943312 missense probably damaging 1.00
R5030:4932438A13Rik UTSW 3 36943399 intron probably benign
R5049:4932438A13Rik UTSW 3 37040506 intron probably benign
R5049:4932438A13Rik UTSW 3 37041390 missense probably damaging 1.00
R5089:4932438A13Rik UTSW 3 36987502 missense probably benign 0.02
R5092:4932438A13Rik UTSW 3 37000085 missense probably benign 0.14
R5122:4932438A13Rik UTSW 3 37034757 splice site probably null
R5210:4932438A13Rik UTSW 3 37033265 missense possibly damaging 0.85
R5246:4932438A13Rik UTSW 3 37048050 missense probably damaging 1.00
R5289:4932438A13Rik UTSW 3 37000109 missense probably damaging 0.97
R5348:4932438A13Rik UTSW 3 37048146 missense probably damaging 1.00
R5394:4932438A13Rik UTSW 3 36917668 missense probably damaging 1.00
R5434:4932438A13Rik UTSW 3 36875516 missense probably damaging 1.00
R5667:4932438A13Rik UTSW 3 36917677 missense probably benign 0.00
R5686:4932438A13Rik UTSW 3 36917660 missense probably benign 0.00
R5701:4932438A13Rik UTSW 3 36921360 missense probably benign 0.10
R5778:4932438A13Rik UTSW 3 36958714 missense probably damaging 1.00
R5787:4932438A13Rik UTSW 3 36992733 splice site probably null
R5800:4932438A13Rik UTSW 3 37052443 missense probably damaging 1.00
R5819:4932438A13Rik UTSW 3 37048600 missense probably benign 0.12
R5820:4932438A13Rik UTSW 3 37039526 missense probably benign 0.00
R5952:4932438A13Rik UTSW 3 36965621 missense probably damaging 1.00
R5975:4932438A13Rik UTSW 3 36969221 missense possibly damaging 0.64
R5996:4932438A13Rik UTSW 3 36931116 missense probably benign 0.07
R6192:4932438A13Rik UTSW 3 36988169 missense probably benign 0.00
R6225:4932438A13Rik UTSW 3 36948304 missense probably damaging 1.00
R6234:4932438A13Rik UTSW 3 36983471 missense probably benign 0.00
R6244:4932438A13Rik UTSW 3 36956999 missense probably benign
R6263:4932438A13Rik UTSW 3 36931111 missense probably benign 0.06
R6351:4932438A13Rik UTSW 3 36908228 missense probably damaging 1.00
R6380:4932438A13Rik UTSW 3 37033307 missense probably benign 0.19
R6468:4932438A13Rik UTSW 3 37008443 missense probably damaging 1.00
R6759:4932438A13Rik UTSW 3 36988085 missense possibly damaging 0.81
R6792:4932438A13Rik UTSW 3 37011566 critical splice acceptor site probably null
R6809:4932438A13Rik UTSW 3 36874282 missense probably damaging 0.98
R6841:4932438A13Rik UTSW 3 37021481 missense probably damaging 1.00
R6959:4932438A13Rik UTSW 3 36967189 missense probably damaging 1.00
R7102:4932438A13Rik UTSW 3 36940798 missense probably damaging 0.99
R7188:4932438A13Rik UTSW 3 36950013 missense probably benign 0.06
R7212:4932438A13Rik UTSW 3 37048009 missense
R7425:4932438A13Rik UTSW 3 36948341 missense probably benign
R7425:4932438A13Rik UTSW 3 36983394 missense probably benign 0.02
R7451:4932438A13Rik UTSW 3 37022807 splice site probably null
R7604:4932438A13Rik UTSW 3 36949843 splice site probably null
R7622:4932438A13Rik UTSW 3 36948413 nonsense probably null
R7671:4932438A13Rik UTSW 3 36943231 missense probably damaging 0.99
R7699:4932438A13Rik UTSW 3 36974172 missense possibly damaging 0.67
R7699:4932438A13Rik UTSW 3 37026154 missense probably benign 0.00
R7700:4932438A13Rik UTSW 3 36974172 missense possibly damaging 0.67
R7700:4932438A13Rik UTSW 3 37026154 missense probably benign 0.00
R7748:4932438A13Rik UTSW 3 36959335 critical splice acceptor site probably null
R7767:4932438A13Rik UTSW 3 36920287 critical splice donor site probably null
R7787:4932438A13Rik UTSW 3 36885408 missense probably damaging 1.00
R7830:4932438A13Rik UTSW 3 36964932 frame shift probably null
R7849:4932438A13Rik UTSW 3 37026328 missense
R7912:4932438A13Rik UTSW 3 37007069 missense probably damaging 0.99
R7914:4932438A13Rik UTSW 3 36946283 missense probably benign 0.13
R7945:4932438A13Rik UTSW 3 36965893 missense probably benign 0.03
R8039:4932438A13Rik UTSW 3 36943214 missense probably benign 0.12
R8101:4932438A13Rik UTSW 3 37008502 missense probably damaging 1.00
R8143:4932438A13Rik UTSW 3 36946508 critical splice donor site probably null
R8145:4932438A13Rik UTSW 3 36998267 missense probably damaging 1.00
R8171:4932438A13Rik UTSW 3 36975713 missense probably benign 0.00
R8210:4932438A13Rik UTSW 3 37012881 missense
R8250:4932438A13Rik UTSW 3 36917662 missense probably damaging 0.99
R8369:4932438A13Rik UTSW 3 37011603 missense
R8478:4932438A13Rik UTSW 3 37033277 missense possibly damaging 0.74
R8558:4932438A13Rik UTSW 3 37048601 missense
R8688:4932438A13Rik UTSW 3 37035917 missense
R8724:4932438A13Rik UTSW 3 36890893 missense probably damaging 0.99
R8869:4932438A13Rik UTSW 3 36958858 missense probably damaging 0.99
R8887:4932438A13Rik UTSW 3 37033354 missense possibly damaging 0.95
R8899:4932438A13Rik UTSW 3 36988280 missense probably damaging 1.00
R8907:4932438A13Rik UTSW 3 36948146 nonsense probably null
R8960:4932438A13Rik UTSW 3 37012983 missense probably damaging 1.00
R8990:4932438A13Rik UTSW 3 36921221 missense possibly damaging 0.60
R9021:4932438A13Rik UTSW 3 36998344 missense probably benign 0.00
R9048:4932438A13Rik UTSW 3 37011777 missense
R9100:4932438A13Rik UTSW 3 37044758 missense
R9166:4932438A13Rik UTSW 3 36987367 missense probably damaging 1.00
R9176:4932438A13Rik UTSW 3 36956703 missense possibly damaging 0.82
R9202:4932438A13Rik UTSW 3 36890821 missense probably benign
R9303:4932438A13Rik UTSW 3 37044820 missense
R9305:4932438A13Rik UTSW 3 37044820 missense
R9332:4932438A13Rik UTSW 3 37050840 missense
R9362:4932438A13Rik UTSW 3 36957013 missense probably benign
R9493:4932438A13Rik UTSW 3 37011736 missense
R9534:4932438A13Rik UTSW 3 36998270 missense probably benign 0.01
R9569:4932438A13Rik UTSW 3 37012621 missense
R9593:4932438A13Rik UTSW 3 36947941 missense probably damaging 1.00
R9600:4932438A13Rik UTSW 3 37041416 nonsense probably null
RF013:4932438A13Rik UTSW 3 37050757 critical splice acceptor site probably benign
RF015:4932438A13Rik UTSW 3 37050748 critical splice acceptor site probably benign
RF021:4932438A13Rik UTSW 3 37050748 critical splice acceptor site probably benign
RF023:4932438A13Rik UTSW 3 37050760 critical splice acceptor site probably benign
RF034:4932438A13Rik UTSW 3 37050760 critical splice acceptor site probably benign
RF035:4932438A13Rik UTSW 3 37050758 critical splice acceptor site probably benign
RF055:4932438A13Rik UTSW 3 37050757 critical splice acceptor site probably benign
X0050:4932438A13Rik UTSW 3 36957128 missense probably damaging 1.00
Z1088:4932438A13Rik UTSW 3 36987567 missense probably damaging 1.00
Z1177:4932438A13Rik UTSW 3 36919950 missense probably benign
Z1177:4932438A13Rik UTSW 3 36983440 missense possibly damaging 0.88
Z1177:4932438A13Rik UTSW 3 37036707 missense
Predicted Primers PCR Primer
(F):5'- TGTAGCCCACAGCCTATGAAAG -3'
(R):5'- CTTACTTTGCCAAATCCAAAAGCTC -3'

Sequencing Primer
(F):5'- GCCTATGAAAGAAGATATTGCAACC -3'
(R):5'- GCAGAGTAAGAAAACAATCCCTTTTG -3'
Posted On 2021-04-30