Incidental Mutation 'R8818:Mphosph9'
ID 672859
Institutional Source Beutler Lab
Gene Symbol Mphosph9
Ensembl Gene ENSMUSG00000038126
Gene Name M-phase phosphoprotein 9
Synonyms MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8818 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 124250959-124327972 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 124324964 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 6 (L6*)
Ref Sequence ENSEMBL: ENSMUSP00000138982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000077376] [ENSMUST00000111477] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000031344
AA Change: L6*
SMART Domains Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: L6*

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
coiled coil region 574 736 N/A INTRINSIC
low complexity region 879 898 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
coiled coil region 1040 1105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077376
SMART Domains Protein: ENSMUSP00000076594
Gene: ENSMUSG00000047635

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:RF-1 51 174 7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111477
SMART Domains Protein: ENSMUSP00000107102
Gene: ENSMUSG00000047635

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:RF-1 51 106 7.1e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130502
AA Change: L6*
SMART Domains Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126
AA Change: L6*

DomainStartEndE-ValueType
low complexity region 47 74 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141203
AA Change: L6*
Predicted Effect probably null
Transcript: ENSMUST00000147737
AA Change: L6*
Predicted Effect probably null
Transcript: ENSMUST00000184951
AA Change: L6*
SMART Domains Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: L6*

DomainStartEndE-ValueType
coiled coil region 102 130 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
low complexity region 444 458 N/A INTRINSIC
coiled coil region 604 766 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
low complexity region 987 1001 N/A INTRINSIC
coiled coil region 1070 1135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,996,548 M3011R possibly damaging Het
Abca14 G T 7: 120,216,301 M257I probably benign Het
Adam23 T C 1: 63,545,468 V345A probably damaging Het
Anxa6 T G 11: 55,011,752 N52T possibly damaging Het
Arhgef15 G A 11: 68,951,112 H496Y probably damaging Het
Atp2a3 A G 11: 72,981,939 E771G probably damaging Het
B3gnt5 A G 16: 19,769,597 T189A possibly damaging Het
Becn1 A T 11: 101,295,404 S125T probably damaging Het
Ccdc180 A G 4: 45,900,484 M283V probably benign Het
Cdh17 T C 4: 11,771,323 F35S probably damaging Het
Clcn1 T A 6: 42,305,543 I515N probably damaging Het
Cyp4f17 A G 17: 32,524,094 Y247C probably damaging Het
Dcp1a T A 14: 30,518,942 H236Q possibly damaging Het
Dnah11 T A 12: 117,911,029 N4034Y probably damaging Het
Dsg1a A G 18: 20,340,542 I891V possibly damaging Het
Eid3 A G 10: 82,867,607 N301D probably damaging Het
Fbrs C A 7: 127,479,522 D108E unknown Het
Fbxw14 A C 9: 109,287,003 probably benign Het
Fzd8 A G 18: 9,214,474 T519A probably benign Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm35911 A T 5: 99,941,235 N120Y probably damaging Het
Gpr3 C A 4: 133,211,227 V45L possibly damaging Het
Gramd1b A T 9: 40,304,484 I690K probably benign Het
Grhl2 T A 15: 37,270,668 D33E probably damaging Het
Kcnj4 C A 15: 79,485,719 R20L probably damaging Het
Klhl5 A G 5: 65,148,646 I319V probably benign Het
Lars2 A T 9: 123,392,827 E135D possibly damaging Het
Map9 T A 3: 82,383,963 Y602N possibly damaging Het
Naa35 C T 13: 59,600,947 T131M probably damaging Het
Nucb2 T A 7: 116,521,901 L22Q possibly damaging Het
Olfr1066 C A 2: 86,455,734 C179F probably damaging Het
Olfr943 A G 9: 39,184,766 Y193C probably damaging Het
Pcdhb6 C T 18: 37,335,784 T586I probably benign Het
Ppcs A T 4: 119,422,133 L74Q probably damaging Het
Ppp6r3 A T 19: 3,467,216 V677D probably benign Het
Psg27 C T 7: 18,560,412 G357S probably damaging Het
Ptgdr2 A G 19: 10,941,016 N299S probably damaging Het
Relb T A 7: 19,619,837 I39F probably damaging Het
Ripor2 T A 13: 24,717,668 S907R possibly damaging Het
Rnf170 T G 8: 26,139,015 D172E probably benign Het
Rnf31 C A 14: 55,594,939 Q273K probably benign Het
Rrp36 A T 17: 46,672,410 S93T probably damaging Het
Rsad1 A T 11: 94,548,274 V120D probably benign Het
Ryr3 C T 2: 112,831,096 A1870T probably damaging Het
Serpina10 T G 12: 103,628,804 D52A probably benign Het
Slc47a1 A G 11: 61,370,229 I115T probably benign Het
Spag17 T A 3: 100,013,227 M426K probably benign Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Sptbn4 T G 7: 27,364,167 E2283A possibly damaging Het
Top3a A G 11: 60,743,051 C740R probably damaging Het
Tpgs2 A T 18: 25,158,308 V33E probably damaging Het
Treh T C 9: 44,681,526 I116T probably damaging Het
Trpm3 A T 19: 22,978,588 N1138I possibly damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Zswim9 G T 7: 13,260,529 Q567K probably benign Het
Other mutations in Mphosph9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mphosph9 APN 5 124262021 missense probably damaging 1.00
IGL01527:Mphosph9 APN 5 124283624 splice site probably benign
IGL01784:Mphosph9 APN 5 124265310 splice site probably benign
IGL01958:Mphosph9 APN 5 124324990 utr 5 prime probably benign
IGL02020:Mphosph9 APN 5 124258950 missense probably damaging 0.99
IGL02190:Mphosph9 APN 5 124265425 missense possibly damaging 0.92
IGL02261:Mphosph9 APN 5 124260087 missense probably damaging 1.00
IGL02569:Mphosph9 APN 5 124297571 nonsense probably null
IGL02640:Mphosph9 APN 5 124315500 missense possibly damaging 0.66
IGL02702:Mphosph9 APN 5 124259989 missense probably damaging 1.00
IGL02793:Mphosph9 APN 5 124283737 critical splice acceptor site probably null
IGL02813:Mphosph9 APN 5 124315628 missense probably benign 0.37
IGL02875:Mphosph9 APN 5 124283737 critical splice acceptor site probably null
IGL03149:Mphosph9 APN 5 124263011 missense probably damaging 1.00
PIT4445001:Mphosph9 UTSW 5 124298790 missense possibly damaging 0.82
R0304:Mphosph9 UTSW 5 124298829 missense probably benign 0.01
R0437:Mphosph9 UTSW 5 124315568 missense probably benign 0.27
R0483:Mphosph9 UTSW 5 124306970 nonsense probably null
R0811:Mphosph9 UTSW 5 124298759 missense probably damaging 1.00
R0812:Mphosph9 UTSW 5 124298759 missense probably damaging 1.00
R0942:Mphosph9 UTSW 5 124262037 nonsense probably null
R1175:Mphosph9 UTSW 5 124315676 missense possibly damaging 0.94
R1372:Mphosph9 UTSW 5 124283745 splice site probably null
R1442:Mphosph9 UTSW 5 124265398 missense possibly damaging 0.62
R1533:Mphosph9 UTSW 5 124267141 missense probably damaging 1.00
R1959:Mphosph9 UTSW 5 124315701 missense possibly damaging 0.92
R2036:Mphosph9 UTSW 5 124304211 missense probably damaging 0.97
R2256:Mphosph9 UTSW 5 124283659 missense probably benign 0.00
R2919:Mphosph9 UTSW 5 124261006 missense probably benign 0.22
R2920:Mphosph9 UTSW 5 124261006 missense probably benign 0.22
R4064:Mphosph9 UTSW 5 124290917 missense probably damaging 1.00
R4272:Mphosph9 UTSW 5 124304203 missense probably damaging 0.96
R4430:Mphosph9 UTSW 5 124265446 missense possibly damaging 0.83
R4883:Mphosph9 UTSW 5 124299045 missense probably damaging 1.00
R4992:Mphosph9 UTSW 5 124304190 missense probably damaging 1.00
R5815:Mphosph9 UTSW 5 124315418 missense probably damaging 1.00
R5993:Mphosph9 UTSW 5 124316098 missense probably benign 0.40
R6102:Mphosph9 UTSW 5 124297709 missense possibly damaging 0.86
R6295:Mphosph9 UTSW 5 124320915 missense possibly damaging 0.46
R6320:Mphosph9 UTSW 5 124324961 missense probably damaging 0.99
R6628:Mphosph9 UTSW 5 124298762 missense probably damaging 0.98
R6692:Mphosph9 UTSW 5 124260116 missense probably damaging 1.00
R6705:Mphosph9 UTSW 5 124290964 missense possibly damaging 0.83
R6747:Mphosph9 UTSW 5 124297699 missense possibly damaging 0.93
R6787:Mphosph9 UTSW 5 124261027 missense probably damaging 0.99
R6850:Mphosph9 UTSW 5 124260956 missense probably damaging 1.00
R6956:Mphosph9 UTSW 5 124297558 missense probably damaging 1.00
R7075:Mphosph9 UTSW 5 124320859 missense probably damaging 0.99
R7604:Mphosph9 UTSW 5 124316117 missense probably benign 0.01
R7789:Mphosph9 UTSW 5 124315587 missense probably damaging 1.00
R7808:Mphosph9 UTSW 5 124260946 missense probably damaging 0.99
R7823:Mphosph9 UTSW 5 124304256 missense probably damaging 0.99
R7891:Mphosph9 UTSW 5 124290904 missense probably damaging 1.00
R8210:Mphosph9 UTSW 5 124267111 missense probably damaging 1.00
R8256:Mphosph9 UTSW 5 124255106 missense probably damaging 1.00
R8385:Mphosph9 UTSW 5 124312722 missense probably benign 0.19
R8438:Mphosph9 UTSW 5 124292392 missense probably benign 0.19
R8692:Mphosph9 UTSW 5 124312812 missense probably damaging 0.99
R8790:Mphosph9 UTSW 5 124315673 missense probably damaging 1.00
R8847:Mphosph9 UTSW 5 124316146 missense possibly damaging 0.91
R9018:Mphosph9 UTSW 5 124298650 missense probably benign 0.12
R9208:Mphosph9 UTSW 5 124312791 missense probably damaging 0.97
R9221:Mphosph9 UTSW 5 124265364 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTAAGGCAAACCAGCAACTATG -3'
(R):5'- GCCGGTTTACAGCAGTTCTC -3'

Sequencing Primer
(F):5'- CCAGCAACTATGTCACTGATTAG -3'
(R):5'- CATTCATTTTCAGACTCTTTGGAAC -3'
Posted On 2021-04-30