Mutagenetix > Incidental Mutations

Incidental Mutation 'R8818:Mphosph9'

672859

Institutional Source

Beutler Lab

Gene Symbol

Mphosph9

Ensembl Gene

ENSMUSG00000038126

Gene Name

M-phase phosphoprotein 9

Synonyms

MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8818 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124250959-124327972 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 124324964 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 6 (L6*)

Ref Sequence

ENSEMBL: ENSMUSP00000138982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000077376] [ENSMUST00000111477] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000031344
AA Change: L6*

SMART Domains

Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: L6*

Domain	Start	End	E-Value	Type
low complexity region	102	119	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
coiled coil region	574	736	N/A	INTRINSIC
low complexity region	879	898	N/A	INTRINSIC
low complexity region	957	971	N/A	INTRINSIC
coiled coil region	1040	1105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000077376

SMART Domains

Protein: ENSMUSP00000076594
Gene: ENSMUSG00000047635

Domain	Start	End	E-Value	Type
low complexity region	9	19	N/A	INTRINSIC
Pfam:RF-1	51	174	7e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111477

SMART Domains

Protein: ENSMUSP00000107102
Gene: ENSMUSG00000047635

Domain	Start	End	E-Value	Type
low complexity region	9	19	N/A	INTRINSIC
Pfam:RF-1	51	106	7.1e-15	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000130502
AA Change: L6*

SMART Domains

Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126
AA Change: L6*

Domain	Start	End	E-Value	Type
low complexity region	47	74	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000141203
AA Change: L6*

Predicted Effect

probably null
Transcript: ENSMUST00000147737
AA Change: L6*

Predicted Effect

probably null
Transcript: ENSMUST00000184951
AA Change: L6*

SMART Domains

Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: L6*

Domain	Start	End	E-Value	Type
coiled coil region	102	130	N/A	INTRINSIC
low complexity region	132	149	N/A	INTRINSIC
low complexity region	158	170	N/A	INTRINSIC
low complexity region	444	458	N/A	INTRINSIC
coiled coil region	604	766	N/A	INTRINSIC
low complexity region	909	928	N/A	INTRINSIC
low complexity region	987	1001	N/A	INTRINSIC
coiled coil region	1070	1135	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (55/56)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	G	3: 36,996,548	M3011R	possibly damaging	Het
Abca14	G	T	7: 120,216,301	M257I	probably benign	Het
Adam23	T	C	1: 63,545,468	V345A	probably damaging	Het
Anxa6	T	G	11: 55,011,752	N52T	possibly damaging	Het
Arhgef15	G	A	11: 68,951,112	H496Y	probably damaging	Het
Atp2a3	A	G	11: 72,981,939	E771G	probably damaging	Het
B3gnt5	A	G	16: 19,769,597	T189A	possibly damaging	Het
Becn1	A	T	11: 101,295,404	S125T	probably damaging	Het
Ccdc180	A	G	4: 45,900,484	M283V	probably benign	Het
Cdh17	T	C	4: 11,771,323	F35S	probably damaging	Het
Clcn1	T	A	6: 42,305,543	I515N	probably damaging	Het
Cyp4f17	A	G	17: 32,524,094	Y247C	probably damaging	Het
Dcp1a	T	A	14: 30,518,942	H236Q	possibly damaging	Het
Dnah11	T	A	12: 117,911,029	N4034Y	probably damaging	Het
Dsg1a	A	G	18: 20,340,542	I891V	possibly damaging	Het
Eid3	A	G	10: 82,867,607	N301D	probably damaging	Het
Fbrs	C	A	7: 127,479,522	D108E	unknown	Het
Fbxw14	A	C	9: 109,287,003		probably benign	Het
Fzd8	A	G	18: 9,214,474	T519A	probably benign	Het
Gldc	C	G	19: 30,100,812	M928I	probably benign	Het
Gm35911	A	T	5: 99,941,235	N120Y	probably damaging	Het
Gpr3	C	A	4: 133,211,227	V45L	possibly damaging	Het
Gramd1b	A	T	9: 40,304,484	I690K	probably benign	Het
Grhl2	T	A	15: 37,270,668	D33E	probably damaging	Het
Kcnj4	C	A	15: 79,485,719	R20L	probably damaging	Het
Klhl5	A	G	5: 65,148,646	I319V	probably benign	Het
Lars2	A	T	9: 123,392,827	E135D	possibly damaging	Het
Map9	T	A	3: 82,383,963	Y602N	possibly damaging	Het
Naa35	C	T	13: 59,600,947	T131M	probably damaging	Het
Nucb2	T	A	7: 116,521,901	L22Q	possibly damaging	Het
Olfr1066	C	A	2: 86,455,734	C179F	probably damaging	Het
Olfr943	A	G	9: 39,184,766	Y193C	probably damaging	Het
Pcdhb6	C	T	18: 37,335,784	T586I	probably benign	Het
Ppcs	A	T	4: 119,422,133	L74Q	probably damaging	Het
Ppp6r3	A	T	19: 3,467,216	V677D	probably benign	Het
Psg27	C	T	7: 18,560,412	G357S	probably damaging	Het
Ptgdr2	A	G	19: 10,941,016	N299S	probably damaging	Het
Relb	T	A	7: 19,619,837	I39F	probably damaging	Het
Ripor2	T	A	13: 24,717,668	S907R	possibly damaging	Het
Rnf170	T	G	8: 26,139,015	D172E	probably benign	Het
Rnf31	C	A	14: 55,594,939	Q273K	probably benign	Het
Rrp36	A	T	17: 46,672,410	S93T	probably damaging	Het
Rsad1	A	T	11: 94,548,274	V120D	probably benign	Het
Ryr3	C	T	2: 112,831,096	A1870T	probably damaging	Het
Serpina10	T	G	12: 103,628,804	D52A	probably benign	Het
Slc47a1	A	G	11: 61,370,229	I115T	probably benign	Het
Spag17	T	A	3: 100,013,227	M426K	probably benign	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Sptbn4	T	G	7: 27,364,167	E2283A	possibly damaging	Het
Top3a	A	G	11: 60,743,051	C740R	probably damaging	Het
Tpgs2	A	T	18: 25,158,308	V33E	probably damaging	Het
Treh	T	C	9: 44,681,526	I116T	probably damaging	Het
Trpm3	A	T	19: 22,978,588	N1138I	possibly damaging	Het
Unc13d	AATGCCTCCCATGCC	AATGCCTCCCATGCCTCCCATGCC	11: 116,068,172		probably benign	Het
Zswim9	G	T	7: 13,260,529	Q567K	probably benign	Het

Other mutations in Mphosph9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Mphosph9	APN	5	124262021	missense	probably damaging	1.00
IGL01527:Mphosph9	APN	5	124283624	splice site	probably benign
IGL01784:Mphosph9	APN	5	124265310	splice site	probably benign
IGL01958:Mphosph9	APN	5	124324990	utr 5 prime	probably benign
IGL02020:Mphosph9	APN	5	124258950	missense	probably damaging	0.99
IGL02190:Mphosph9	APN	5	124265425	missense	possibly damaging	0.92
IGL02261:Mphosph9	APN	5	124260087	missense	probably damaging	1.00
IGL02569:Mphosph9	APN	5	124297571	nonsense	probably null
IGL02640:Mphosph9	APN	5	124315500	missense	possibly damaging	0.66
IGL02702:Mphosph9	APN	5	124259989	missense	probably damaging	1.00
IGL02793:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL02813:Mphosph9	APN	5	124315628	missense	probably benign	0.37
IGL02875:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL03149:Mphosph9	APN	5	124263011	missense	probably damaging	1.00
PIT4445001:Mphosph9	UTSW	5	124298790	missense	possibly damaging	0.82
R0304:Mphosph9	UTSW	5	124298829	missense	probably benign	0.01
R0437:Mphosph9	UTSW	5	124315568	missense	probably benign	0.27
R0483:Mphosph9	UTSW	5	124306970	nonsense	probably null
R0811:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0812:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0942:Mphosph9	UTSW	5	124262037	nonsense	probably null
R1175:Mphosph9	UTSW	5	124315676	missense	possibly damaging	0.94
R1372:Mphosph9	UTSW	5	124283745	splice site	probably null
R1442:Mphosph9	UTSW	5	124265398	missense	possibly damaging	0.62
R1533:Mphosph9	UTSW	5	124267141	missense	probably damaging	1.00
R1959:Mphosph9	UTSW	5	124315701	missense	possibly damaging	0.92
R2036:Mphosph9	UTSW	5	124304211	missense	probably damaging	0.97
R2256:Mphosph9	UTSW	5	124283659	missense	probably benign	0.00
R2919:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R2920:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R4064:Mphosph9	UTSW	5	124290917	missense	probably damaging	1.00
R4272:Mphosph9	UTSW	5	124304203	missense	probably damaging	0.96
R4430:Mphosph9	UTSW	5	124265446	missense	possibly damaging	0.83
R4883:Mphosph9	UTSW	5	124299045	missense	probably damaging	1.00
R4992:Mphosph9	UTSW	5	124304190	missense	probably damaging	1.00
R5815:Mphosph9	UTSW	5	124315418	missense	probably damaging	1.00
R5993:Mphosph9	UTSW	5	124316098	missense	probably benign	0.40
R6102:Mphosph9	UTSW	5	124297709	missense	possibly damaging	0.86
R6295:Mphosph9	UTSW	5	124320915	missense	possibly damaging	0.46
R6320:Mphosph9	UTSW	5	124324961	missense	probably damaging	0.99
R6628:Mphosph9	UTSW	5	124298762	missense	probably damaging	0.98
R6692:Mphosph9	UTSW	5	124260116	missense	probably damaging	1.00
R6705:Mphosph9	UTSW	5	124290964	missense	possibly damaging	0.83
R6747:Mphosph9	UTSW	5	124297699	missense	possibly damaging	0.93
R6787:Mphosph9	UTSW	5	124261027	missense	probably damaging	0.99
R6850:Mphosph9	UTSW	5	124260956	missense	probably damaging	1.00
R6956:Mphosph9	UTSW	5	124297558	missense	probably damaging	1.00
R7075:Mphosph9	UTSW	5	124320859	missense	probably damaging	0.99
R7604:Mphosph9	UTSW	5	124316117	missense	probably benign	0.01
R7789:Mphosph9	UTSW	5	124315587	missense	probably damaging	1.00
R7808:Mphosph9	UTSW	5	124260946	missense	probably damaging	0.99
R7823:Mphosph9	UTSW	5	124304256	missense	probably damaging	0.99
R7891:Mphosph9	UTSW	5	124290904	missense	probably damaging	1.00
R8210:Mphosph9	UTSW	5	124267111	missense	probably damaging	1.00
R8256:Mphosph9	UTSW	5	124255106	missense	probably damaging	1.00
R8385:Mphosph9	UTSW	5	124312722	missense	probably benign	0.19
R8438:Mphosph9	UTSW	5	124292392	missense	probably benign	0.19
R8692:Mphosph9	UTSW	5	124312812	missense	probably damaging	0.99
R8790:Mphosph9	UTSW	5	124315673	missense	probably damaging	1.00
R8847:Mphosph9	UTSW	5	124316146	missense	possibly damaging	0.91
R9018:Mphosph9	UTSW	5	124298650	missense	probably benign	0.12
R9208:Mphosph9	UTSW	5	124312791	missense	probably damaging	0.97
R9221:Mphosph9	UTSW	5	124265364	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TTAAGGCAAACCAGCAACTATG -3'
(R):5'- GCCGGTTTACAGCAGTTCTC -3'

Sequencing Primer
(F):5'- CCAGCAACTATGTCACTGATTAG -3'
(R):5'- CATTCATTTTCAGACTCTTTGGAAC -3'

Posted On

2021-04-30